Hyena carrying capacity in Mkomazi National Park is 500 (in the absence of competitors). Wild Dog carrying capacity in that park is 700 (in the absence of competitors). The addition of 1 wild dog to the park is equivalent to adding 2.5 hyena. The addition of 1 hyena to the park is equivalent to adding 0.4 wild dogs. Which of these species is the better competitor? Justify your answer quantitatively and illustrate your argument using an appropriate graph.
Q: Answer the following questions using the virtual lab light phase video. Where do the electrons for…
A: Photosynthesis is a process by which green plants absorb carbon dioxide, sunlight, and split water…
Q: Recombination and independent assortment are two events that occur in the life cycle of an animal…
A: Animal Life Cycle: After emerging from eggs or live birth, animals mature and mate. Animals might…
Q: Which of the following proteins does not belong in this group? A. Ovalbumin < BUDE Ferritin C.…
A: Proteins are a sequence of amino acids which have four levels of structure such as primary,…
Q: Which is a mechanism by which competitors are able to successfully coexist? The competitors…
A: It involves competitors dividing and utilizing available resources in a way that reduces direct…
Q: Q6.6. If gametes from a gene pool combine randomly to make only a small number of zygotes, the…
A: The objective of the question is to understand why allele frequencies among zygotes may differ from…
Q: 1. The B-galactosidase gene of the lac operon is expressed at high level when which combination of…
A: High lactose concentration induces the production of the B-galactosidase enzyme. Lactose acts as an…
Q: Walk through the steps of linear regression in the context of a trait and a genotype. Define the x…
A: Linear regression is a powerful statistical tool that can be utilized in genetics to investigate the…
Q: QUESTION 17 In the regulation of blood pressure, juxtaglomerular cells respond most to changes in…
A: This request concerns blood pressure control and the part that juxtaglomerular cells play in this…
Q: Can you explain the various options and how did you come to the answer? How to determine when…
A: An acid is a molecule or ion capable of either donating a proton(Bronsted-Lowry acid) or forming a…
Q: How have species of streptomyces contributed to the treatment of infectious diseases?
A: Bacteria, an organic cell, represent a vast domain of prokaryotic microbes. Bacteria are typically a…
Q: Members of which of the following classes are examples of vertebrate animals that are not amniotes?…
A: Vertebrate animals can be grouped into two categories based on the presence or absence of certain…
Q: The B-cell co-receptor, composed of CD19/CD21/CD81, is a receptor that binds to complement fragments…
A: A co-receptor is a type of cell surface receptor that functions by binding a signaling molecule in…
Q: transduction Would result in the false grouping of distantly related bacteria on a phylogeny:…
A: Bacteria are the microscopic, single-celled organisms that exist in millions, in the environment.…
Q: topic: norovirus research on its: A. Definition B. General characteristics C. How is it associated…
A: A virus is a microscopic infectious entity that can only reproduce within an organism's live cells.…
Q: Write an 800-word essay on debunking this myth about cancer from "Myth Buster by Ted Koren 2012…
A: Cancer is a disease in which some of the body cells grow uncontrollably and spread up to other parts…
Q: patient that is losing blood rapidly, a decrease in blood volume results in a decrease in cardiac…
A: The blood pumped by the ventricles of the heart per minute is called cardiac output. Normal cardiac…
Q: Membrane Receptors and Medicine. A patient, who has a stressful job, comes in with high blood…
A: The use of beta-blockers in the management of hypertension represents a pharmacological approach to…
Q: Match the tissue shown with its function. option: 1. Present in bone marrow, spleen, and lymph…
A: Tissues are historically derived biological term organizing level in biology that lies between…
Q: Genes a and b are 20 cM apart. An a+ b+/a b individual was mated with an a b/a b individual. Which…
A: If two genes are located on the same chromosome then they are classified as linked genes. In this…
Q: You have set up a fly cross between red-eyed male flies and white-eyed female flies. Several days…
A: The objective of the question is to determine the most likely genetic inheritance pattern for the…
Q: Why is it difficult to study whether a trait is due to epigenetic changes or due to something else?…
A: The objective of the question is to understand the challenges in studying the role of epigenetic…
Q: why should contraceptives be free
A: The question is asking for reasons why contraceptives should be provided for free. Contraceptives…
Q: Would nitrosylation of cysteine or ubiquitination of lysine disrupt binding the most in a G protein…
A: Let's understand how nitrosylation of cysteine and ubiquitination of lysine can potentially disrupt…
Q: The best available science did not support the bereavement exclusion. Explain the details…
A: In the context of the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text…
Q: Discuss Tidal, residual, minimal air in Gaseous Exchange in Animals
A: The volume of the human lungs exhibits variation between individuals based on factors such as body…
Q: Arrange the following components of translation in the approximate order in which they would appear…
A: The method of protein synthesis, or translation, in prokaryotes includes a series of complex steps…
Q: In your own words, explain how genetic ancestry testing works. (Minimum of 2 complete sentences.)
A: Genetic ancestry testing, also known as genetic genealogy, is a method for people interested in…
Q: In your own words, explain one of the following results that happened after a population went…
A: The question is asking for an explanation of the biological and physiological changes that occurred…
Q: Which of the following animals show the characteristics required to be a chordate? A. Tunicates…
A: Chordates are a phylum of animals characterized by certain key features, including a notochord,…
Q: Based on the maps above, in which areas would you find the greatest marine biodiversity? A…
A: The inquiry centers on identifying regions exhibiting the highest marine biodiversity by…
Q: Which of the following is not true of the sickle-cell allele? a)it became an important genetic…
A: The question is asking us to identify the statement that is not true about the sickle-cell allele.…
Q: an experiment to test the effectiveness of a medication, researchers may use both a standard control…
A: In any experiment there is relevance of all the standard treatment control groups and the placebos…
Q: 6. The famous geneticist, T.H. Morgan, carried out a series of experiments on linkage mapping in…
A: Disclaimer: "Since, you have multiple questions, only first question to be answered according to the…
Q: Why were chloroplasts selected for the pigment extraction in the virtual lab?
A: Chloroplasts are the type of plastids. These are the double membraned cell organelles which is…
Q: Which of the following animals has indirect development (larvae)? A. Salamander B. Bony fish…
A: Animal development begins with a single cell known as a zygote, which is a fertilized egg. According…
Q: Lean mice (+/+) were reared so they had microbe-free guts. Two groups of lean mice were injected,…
A: The study described involves lean mice that were raised to have microbe-free guts and then injected…
Q: Compare the structure of an icosahedral capsid with that of a helical capsid. How do pentamers and…
A: Capsid is an outer covering of viruses which is made up of proteins. It encloses the genome of a…
Q: Part II. for a single DNA marker. Below that is a diagram representing the chromosomes of these same…
A: The image and graph, alluding to are part of a genotyping process, which may be a way to analyze the…
Q: I am testing the prediction that spiders with colors that match a flower (cryptic coloration) will…
A: A research study involves experimentation and observation of variables to establish valid…
Q: explain Tibetan genetics pertaining to high-altitude living and give me a brief summary of how it…
A: The question is asking for an explanation of the genetic adaptations that have allowed the Tibetan…
Q: sure of the sugar G3P? a. Light energy directly provides energy to RuBP and CO2, which produce G3P…
A: Photosynthesis is a process by which green plants prepare their own food in the form of glucose with…
Q: 5' GTATGTTACGTAACCTCTGCCTGCTAAGGGTAGAATATAGCTACGCTATCGATGGTAGCTAGCGATCG 3' a b с 29) Examine the…
A: This question asks to identify the binding site for the transcription factor TFIID in a given DNA…
Q: This figure comes from an article about predicting protein structures with a multiplayer online ame…
A: Based on the figure and the descriptions you have provided, here is a summary of the trends and…
Q: Which statement about the relationship between specialization and obligacy are true? Some but not…
A: Specialization in ecology refers to the adaptation of a species to perform specific functions or…
Q: What are the results from the gram stain and result of the API strip ? (Positive/ negative) for each…
A: The bioMerieux catalog/APIweb is a software product that contains all of the API databases for a…
Q: Explain the multiple testing problem of GWAS - why do we need such a small p-value to achieve…
A: Imagine you're flipping a coin a bunch of times. If you only flip it once, getting heads might not…
Q: more variety amongst groups than between them. O True -False
A: Q3.Racial traits, including skin color, are accuratе indicators of gеographic origins because human…
Q: F1 results Cross A: white eyed male + wild type red female Males red eyes 132 Females red eyes 135…
A: In this genetic study, we have data from two crosses, Cross A and Cross B, involving Drosophila…
Q: Determine the CFU/ml of the original culture in the image below. Write your value in scientific…
A: Serial dilution is a process by which a sample with an unknown concentration is used to calculate…
Q: 2 23 Phytophthora infestans 24 n Flagella movement Flagella movement They are found in Mexico on the…
A: Carolus Linneaus is known as the father of taxonomy. He proposed the two-kingdom classification…
Hyena
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 1 images
- You are interested in studying intraspecific competition among tadpoles (the immature stage of frogs, which live in freshwater habitats). You survey three tiny ponds to count the number of tadpoles: one pond has 0 tadpoles, one pond has 10 tadpoles, and one pond has 100 tadpoles. The consumer-weighted density estimate used to quantify the potential for intraspecific competition is as follows: Mean number of tadpoles per tadpole Number of tadpoles present in \the pond where tadpole i is located, Total number of tadpolès N=total number of tadpoles Using this equation, the resource-weighted density estimate across these three ponds is O a. 36.67 tadpoles/pond O b. 110 tadpoles/pond O c. 30.33 tadpoles/tadpole O d. 55 tadpoles/tadpole O e. 91.8 tadpoles/tadpoleThe relationship between predator and prey populations has been studied by computer simulation using equations which form part of a mathematical model devised by Lotka and Volterra. The data in Table 6.10 show the results of such a simulation when the prey population begins with 20 individuals and the predator population begins with six individuals. 1.Explain why the peaks in the predator population occur after those in the prey population. 2. This simulation assumes one prey species and one predator species in an imaginary ecosystem and is based on mathematical equations. Why is it likely to be too simplistic to describe accurately what happens in nature?African elephants are threatened by poachers, who kill the elephants for their tusks. Both male and female elephants can grow tusks. There are some elephants that are tuskless (do not grow tusks). In the elephant population of Gorongosa National Park, the number of female elephants was monitored for many years. The graphs show the total female elephant population and the percent of tuskless females in that population from 1970 to 2015. Which of the following describes the trend in the female elephant population from 1970 to 1995 ? The overall population decreased, and the proportion without tusks increased. Answer A: The overall population decreased, and the proportion without tusks increased. A The overall population decreased, and the proportion without tusks decreased. Answer B: The overall population decreased, and the proportion without tusks decreased. B The overall population increased and then decreased, and the proportion without tusks…
- A coyote population in Colorado has 40 individuals, the potential reproductive rate per individual per year is 1.5, and the carrying capacity of the area is 50 coyotes. In the same habitat, the bobcat population has 30 individuals, the potential reproductive rate per individual per year is 2, and the carrying capacity of the area is 100 bobcats. The bobcats depress population growth of coyotes through competition by 0.20, while the coyotes depress population growth of bobcats through competition by 1.1. What will the population size be for coyotes next year? *Note that this is the other half of the bobcat question, and you need to round your answer to a whole animal. 40 5 45 16 55A population of 1,492 finches is introduced to a rainforest. Over the next year, the finches show a death rate of 0.395 while the population drops to 1,134. What's the birth rate for this population? Is this proving to be a suitable habitat? (Two answers) * Yes, this is a suitable habitat. The birth rate is higher than the death rate. No, this is not a suitable habitat. The birth rate is much lower then the death rate. 589 -358 0.155 0.845 Which of the following is true of a population approaching its carrying capacity? The population's rate of increase approaches zero. ロロロ□Mark Recapture can be written as M N = R Define each term. Use this equation to answer the following question. Show your work. A biologist for Mosaic fertilizer company catches 26 Florida scrub jays as part of their monthly environmental monitoring. Each bird is given a band. The next month, they catch 32 birds. 13 of the birds have bands. What is the estimated population size of the birds in that area?
- American crows (species 1) compete with Turkey Vultures (species 2) for carrion. Vultures are 4x as large as crows and eat 4x as much. They also can chase Crows away from carcasses. Therefore, one additional vulture in an area displaces four crows, but it takes 10 additional crows to displace one vulture. The competition coefficients are O alpha12 (imaging the greek alpha with subsript 12) = 10, alpha21 = 4 O alpha12 = 4, alpha21 = 10 O alpha12 = 4, alpha21 = 0.1 O alpha12 0.1, alpha21 = 4In 2010, 150 coyotes (Canis latrans) were counted in Pierce County, WA. And the growth rate is 14 coyortes per year. Following a survey of the community, the social carrying capacity of coyotes was around 500 individuals. How long will it take for the coyote population to reach this human tolerance goal? Biologists have estimated the biological carrying capacity for coyotes in the county to be 1000 individuals. How long will it be before the population reaches carrying capacity using exponential growth? Would it take more or less time for the population to reach carrying capacity if using logistic growth equation and assumptions?Which of the following would have the largest capture efficiency in the Lotka-Volterra model of predator-victim interactions? A caterpillar eating a plant A bat eating mosquitoes A small tarantula wasp eating a much larger tarantula A killer whale eating a seal Which of the following is NOT an assumption of the Lotka-Volterra model of predator-victim interactions? Prey have limited resource availability No age, stage or size structure in the population Continuous population growth (no pulses or lags) Victims and predators encounter each other at random Predator is a complete specialist O O
- You are part of a group of researchers examining the survivorship and fecundity of Bengal Tigers (Panthera tigris tigris) in the Kalakkad Mundanthurai Tiger Reserve in the South Indian state of Tamil Nadu. Parts of the reserve are well-protected from poaching, and other parts are largely unprotected. Over a period of several years, you’ve gathered demographic data (summarized below) on tigers in both poached and unpoached locations; assume that mx numbers represent female offspring born per female. Note that your demographic data begins at age 1, and does not include survivorship of cubs from birth to age 1. Also, note that Sx is listed here -- this is related to, but is NOT the same as lx… To calculate r, use the formula r = ln(Ro)/T. Including unpoached poaching Tiger age (x) Sx Sx Mx 0 1 1 0 1 0 2 0.83 0.69 0.04 3 0.91 0.65 0.64 4 0.9 0.62 0.78 5 0.85 0.6 0.71 6…For the cricket, the intrinsic growth rate is 100 and the carrying capacity of the environment is 200,000 individuals. For the frog, the capture efficiency is 0.0002, the conversion efficiency is 0.1, the handling time per cricket is 0.2 hours, and the density-independent per capita death rate of the predator is 0.4. 18. At what value of the number of crickets is the predator population of frogs at equilibrium? 19. What is the dN/dt of the prey population when the number of frogs is 60 and the number of crickets is 11,000? Round to the nearest hundredth. 20. What is the dP/dt of the predator population when the number of frogs is 60 and the number of crickets is 11,000? Round to the nearest hundredth.Calculate the rate of population change for a hypothetical population of wildebeest using the logistics equation and carrying capacity equation. How can you explain these results? N = 500, r = 0.1, K = 1000, calculate dN/dt.