This is homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it! How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fullyprocessed MRNA.9.1. Normal DNAMutant DNAATGGCGGAAGACGTAATGGCGGAGGACGTATACCGCCTTCTGCATTACCGCCTCCTGCATWhat type of mutation is this at the DNA level?What type of mutation is this at the protein level?Normal DNA10.Mutant DNAATGGCGGACGACGTAАTGGCGGTCGАCСТАTACCGCCTGCTGCATTACCGCCAGCTGCATWhat type of mutation is this at the DNA level?What type of mutation is this at the protein level?11.Normal DNAMutant DNAATGGCGGAGGACCAAATGGCGGAGGACTAATACCGCCTCCTGGTTTACCGCCTCCTGATTWhat type of mutation is this at the DNA level?What type of mutation is this at the protein level? 12.Normal DNAMutant DNAATGGCGGAGGACCTAAATGGCGTGATGGCGAGGACCTAAATGGCGTGТАСССССТССТGGATTTACCGCAСTACCGCTCCTGGATTTACCGCACWhat type of mutation is this at the DNA level?What type of mutation is this at the protein level?

DNA and RNA differ in only one of the four nitrogenous bases. RNA has uracil instead of thymine. DNA…

How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully processed MRNA. 9. 1. Normal DNA Mutant DNA ATGGCGGAAGACGTA ATGGCGGAGGACGTA TACCGCCTTCTGCAT TACCGCCTCCTGCAT What type of mutation is this at the DNA level? What type of mutation is this at the protein level? 10. Normal DNA ATGGCGGACGACGTA Mutant DNA ATGGCGGTCGACGTA TACCGCCAGCTGCAT TACCGCCTGCTGCAT What type of mutation is this at the DNA level? What type of mutation is this at the protein level? 11. Normal DNA Mutant DNA ATGGCGGAGGACCAA ATGGCGGAGGACTAA TACCGCCTCCTGGTT TACCGCCTCCTGATT What type of mutation is this at the DNA level? What type of mutation is this at the protein level?

How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully processed MRNA. 9. 1. Normal DNA Mutant DNA ATGGCGGAAGACGTA ATGGCGGAGGACGTA TACCGCCTTCTGCAT TACCGCCTCCTGCAT What type of mutation is this at the DNA level? What type of mutation is this at the protein level? 10. Normal DNA ATGGCGGACGACGTA Mutant DNA ATGGCGGTCGACGTA TACCGCCAGCTGCAT TACCGCCTGCTGCAT What type of mutation is this at the DNA level? What type of mutation is this at the protein level? 11. Normal DNA Mutant DNA ATGGCGGAGGACCAA ATGGCGGAGGACTAA TACCGCCTCCTGGTT TACCGCCTCCTGATT What type of mutation is this at the DNA level? What type of mutation is this at the protein level?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 29CTQ: A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that...

See similar textbooks

Similar questions

Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
7:25 7 copiea imto a new molecule of RNA. What happens during the TERMINATION step of transcription? A. base pairs are added to the mRNA transcript B. RNA polymerase starts creating the mRNA transcript C. RNA polymerase stops adding bases to the mRNA transcript, causing the mRNA to separate from the DNA Copyright © 2003 - 2022 International Academy of Science. All Rights Reserved. 7
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
10:39 E DNA/RNA/PROTEIN SYNTHESIS/M... 18 of 20 A DNA nucleotide is composed of what three parts and are held together by Phosphate, ribose, nitrogenous base and held together by hydrogen bonds Phosphate, deoxyribose and held together by hydrogen bonds Phosphate, ribose and held together by covalent bonds Phosphate, deoxyribose, nitrogenous base and held together by hydrogen bonds Next > II
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.