Q: The overall goal of chemiosmosis is to make Select one: O a. NADH, Kreb's Cycle O b. NADPH, Calvin…
A: Introduction : The electron transport system/chain, or ETS/C, is the metabolic mechanism of…
Q: What type of error will occur if starch is added too early in the Winkler analysis? A. Positive…
A: Starch is a type of carbohydrate found in many foods, including grains, potatoes, corn and rice. It…
Q: DNA has the O thymine; uracil nucleotide, whereas RNA has the thymine; adenine O adenine; cytosine O…
A: INTRODUCTION DNA : Deoxyribonuleic acid RNA : Ribonucleic acid
Q: What is the difference between Lantana camara Linn and Lantana camara Mill?
A: Lantana camara Linn. It is both a weed and a popular houseplant. Plants have been used as a source…
Q: Glomerular filtration rate is controlled by: 1. autoregulation mechanisms, including…
A: The process of generating urine begins with glomerular filtration. The kidneys utilize this…
Q: Which of the following statements is true? O a. Alcohol dehydrogenase catalyzes the conversion of…
A: Fermentation is the metabolic process, in which an organism converts carbohydrate (starch or sugar )…
Q: Decomposers cannot obtain their energy directly by photosynthesis.
A: Plants and other living things employ a process called photosynthesis to transform light energy into…
Q: How does the body regulate blood glucose
A: Introduction Maintenance of blood glucose level is very important to maintain the homeostasis in the…
Q: Which of the following statements regarding retroviruses is FALSE? A) a cellular enzyme converts…
A: Normally virus can have genetic material as either RNA or DNA. Retrovirus is a type of virus which…
Q: Ch. 6: The major buffering system of the extracellular fluid (ECF) is: a) the bicarbonate-carbonic…
A: Introduction Buffer is the solution that resists the change in pH when an acidic solution or a basic…
Q: 5. The Hardy-Weinberg Principle states that gene frequencies in a population are overall conserved.…
A: The Hardy-Weinberg Principle is a basic principle of population genetics that states that allele…
Q: The evolution / development of the skeletal system of the vertebrate is an example of the process of…
A: Osteoblasts create both endochondral and intramembranous bones, whereas osteoclasts destroy the…
Q: Camegie Embryonic Development Carnegie Age (Day Stage or Week) Fetal Development Trimester Week…
A: The unborn offspring in humans that develops and grows inside the uterus or the womb. The fetal…
Q: How can fluid composition help distinguish the two types of pleural effusion
A: The fluid composition in our body varies depending on the specific type of fluid. For example, the…
Q: The compound glucose 6-phosphate is NOT encountered in which of the following processes? conversion…
A: Glucose 6-phosphate is an important intermediate in the metabolism of glucose. It is formed from…
Q: In an excitable cell at rest, we expect to find ______ ions effluxing out of the cell through leak…
A: The cell is said to be at resting membrane potential when the cell potential is at rest, and the…
Q: The multicellular body plan (demonstrated by the Porifera, sponges) are possible because of the…
A: These methods cannot be used to liberate transmembrane proteins, many proteins retained in the…
Q: Cytosolic concentration of calcium in cells is typically because calcium is -
A: Cytosolic concentration means the concentration of calcium inside the cytosol. The cytosol is the…
Q: Fat oxidation is mainly influenced by ______ availability and the rate of _______ utilization. Group…
A: Facts are one of the essential nutrients which is required as a energy giving food along with…
Q: The following is a picture of Eosin Methylene Blue Agar. What does the growth on this plate…
A: Eosin Methylene Blue (EMB) agar is a selective and differential culture medium which selectively…
Q: The pacemaker potential describes a slow depolarization of the membrane from -60 mV to -40 mV to…
A: A small structure known as the sinoatrial node (SAN) is located in the right atrium, close to the…
Q: If you map two different organims daily movements, and see these types of patterns, answer the…
A: Navigation is a way of finding the direction of a particular path by sensing environmental…
Q: QUESTION 13 Which of the following is NOT true about the function of vacuoles? O a. Storage of waste…
A: The cell has been divided into cell organelles. Division of labor is also visible at the organelle…
Q: Create a concept map or an illustration drawing for each phylum (annelida, Platyhelminthes, nemotod,…
A: Concept maps are visualized representations of information that are presented in the form of graphs,…
Q: Actin (which makes up the cytoskeleton) is an example of a/an Select one: a. enzyme, structural…
A: Proteins are the polymers of amino acids. Proteins perform diverse functions in the cells.
Q: What is the relationship between the structure and function of proteins and how are they are…
A: Proteins are made up of a very long chain of many amino acids. Even with a limited no. of amino acid…
Q: Which of the following alterations of chromosome structure is less likely to produce negative health…
A: Chromosome mutations in biology refer to the alteration of DNA strands that make up the chromosomal…
Q: explain the mechanism by which acid growth happens. Why is acid growth important for plants?
A: The expansion dynamics of cells and organs in plants are explained by the acid-growth hypothesis.…
Q: QUESTION 47 Ribosomes are O a. composed of rRNA and proteins b. composed of mRNA and DNA O c. always…
A: A ribosome is an intercellular structure. Ribosome is the site of protein synthesis in the cell.…
Q: Describe how alterations in bacterial genes can be beneficial and harmful to humans. Include ONE…
A: Bacterial DNA is the genetic material that makes up bacterial cells. It contains all of the…
Q: We now have at least three SARS-CoV-2/COVID-19 vaccines approved by the FDA for use in the United…
A: The vaccines are: 1. Pfizer-BioNTech – Authorized on December 11, 2020 2. Moderna – Authorized on…
Q: ) Two islands with similar topologies have the same size and same distance from the mainland. One…
A: Two islands with similar topology mean they have connected in the same way.vicariance means…
Q: Unlike kinesins, dyneins are not directly attached to their target cargo molecules. They instead use…
A: Dynein is involved in the movement of chromosomes and positioning the mitotic spindles for cell…
Q: _________________________ is responsible for bringing ATP-actin to the _________ of microfilaments.…
A: Answer and explanation - Profilin is responsible for bringing ATP-actin to the barbed of…
Q: Which of the following will promote apoptosis? Select one: a. electron transfer in cytochrome c Ob.…
A: Apoptosis is programmed cell death which is used to eliminate unwanted cells. Apoptosis carries a…
Q: h. 5: All of the following are true about cystic fibrosis EXCEPT: a) it affects a membrane calcium…
A: Introduction Cystic fibrosis refers to a chronic and serious genetic disorder or condition that…
Q: 8. Justify the benefits of conducting face to face interview for a new employee
A: ANSWER) Face to face interview is when the candidate and the jury have a conversion in physical…
Q: Describe the cellular and vascular events of inflammation which lead to the four classic signs of…
A: The cellular response to short-term cell injury or infection is known as acute inflammation. Acute…
Q: Ch. 7: Which type of renal calculi can be dissolved by raising urine pH with potassium citrate? a)…
A: INTRODUCTION Renal calculi It is hard depositions of minerals and acid salts formed in kidney and…
Q: PLACE THE FOLLOWING IN THE CORRECT ORDER FROM THE TESTIS place you cursor on the dots to toggle the…
A: Introduction: Sperm is a male germ cell or male reproductive cell that is created by males in the…
Q: What pathway does sound follow through the ear? O pinna; ossicles; oval window; tympanic membrane;…
A: Ear is the sensory organ which conducts sound waves from external environment into the inner ear and…
Q: Compare and contrast the processes of bacterial replication, bacterial transcription, and bacterial…
A: An explanation of the movement of genetic information within a biological system is the core tenet…
Q: A scientist wants to make a random mutation in a specific gene to investigate that gene's function.…
A: A random mutation is a change in the sequence of nucleotides that makes up an organism's genetic…
Q: apply the knowledge of the ways by which materials, including those used in implants and sensors,…
A: The term "biocompatibility" refers to compability of materials to exist with living cell/ tissues or…
Q: Hemocytes are stem cells which become plasma cells of the white blood cell system. These cells…
A: The rough endoplasmic reticulum produces secretory proteins and membranes. Through the process of…
Q: Excitable cells in the nervous system that generate and transmit electrochemical impulses are called…
A: The nervous system is the body’s control center and communication network. It consists of the brain,…
Q: What best explains the mechanism of old (and wicked dangerous) diet pills that acted as an…
A: Answer. The correct option is (a) a. It decreased efficiency of oxidative phosphorylation
Q: Oxidation of ingested CHO during exercise depends on each of the following variables except... Group…
A: Carbohydrates are one of the essential nutrients present in the food. It is made up of carbon,…
Q: Propose a protocol (~100 words) to study the efficacy of the antibody in this mouse model.
A: According to the given data, factor 801A is transduction molecule essential for growth of ovarian…
Q: B-cells participate in Select one: immunity and produce innate, proteasome inhibitors Ob. innate,…
A: The lymphocyte class known as B cells is in charge of the humoral immunity portion of the adaptive…
Step by step
Solved in 3 steps
- The exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being amplified. Consider a 10-kbp DNA sequence in a genome of 1010 base pairs. What fraction of the genome is represented by this sequence; i.e., what is the fractional abundance of this sequence in this genome? Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on gel electrophoresis, specific sequences can be amplified by PCR. For a sequence of a 100 base pairs, calculate the number cycles of PCR required to generate 1 ng of DNA, when starting from a single copy. Note that the molar mass of an average DNA bp is 600 g/mol.The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being amplified. Consider a 10-kbp DNA sequence in agenome of 1010 base pairs. What fraction of the genome does this sequence represent? That is, what is the fractional abundance of this sequence in this genome?Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.
- The final amount of each primer required in a PCR reaction is 25 picomol. If the total volume of the PCR reaction is equal to 100 µl and the stock concentration of each primer is equal to 0.0025 mM. Calculate the volume of stock primer that needs to be added in order to ensure a primer amount of 25 picomol.You are given a tube containing 275 ng of purified PCR product (DNA) that is 1262 bp long. How many picomoles of PCR product are in the tube? The average molecular weight of a deoxynucleotide monophosphate is 328 g/mol.Explain why a positive control and negative control are included in PCR experiments. Explain the three steps involved in each cycle of polymerase chain reaction.Why is loading dye added to the DNA sample for gel electrophoresis? Explain the function of the following components in a PCR reaction:− Primer, dNTP, MgCl, Taq polymerase, buffer.
- Our PCR samples already contain loading dye, but sometimes this isn’t the case. If your samples didn’t already contain dye and you wanted to load your PCR sample onto an agarose gel, you’d need to add loading dye to the proper concentration. There is a 6X loading dye available for use; how many µl of this loading dye will you add to 10 µl of your sample so that it is at a 1X working concentration? Show your work.Calculate the volume (in µL) of DNA template required to add 60.0 ng to a 40.0 µL PCR if the DNA template is at a concentration of 28.0 ng µL-1.PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…
- To be able to properly analyze a sample of DNA, you need to have at least 1 µg of the DNA of interest. Assumptions: PCR is run with 30 cycles; Molecular weight per nucleotide in DNA is about 660 g/bp (330 g/bp for single stranded DNA or RNA); bp = base pair. a. Given that you can use the Polymerase Chain Reaction (PCR) to amplify DNA from the original sample and the size of the fragment to be amplified is 10,000 nucleotides long, estimate how many DNA molecules you need to obtain the minimum amount required to analyze the sample. b. Suggest a way to increase your sensitivity, i.e. amplify the DNA starting from even fewer molecules of template DNA.Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…You Purified plasmid DNA (a 6.0 kb vector) and got the following results... DNA conc: 200 ng/µL A260/280: 1.97 A260/230: 2.15 How would you to set up a ligation reaction with 50 ng of digested DNA and a 1254 base pair PCR insert present at a concentration of 23 ng/µL. How should you pipet the necessary nucleotide components (vector and PCR insert) to obtain a 1:5 vector to insert molar ratio? Keep in mind limitations of pipets when giving your answer.(e.g. Pipetes won't go below 0.5µL)