Genome. Wide Association Studies: use chip-based array to correlate disease symptoms to SNPs use genomic sequencing technology to correlate disease symptoms to SNPs use small fragment DNA sequencing technology (e.g., Sanger Sequencing) to correlate disease symptoms to SNPs sequence exomes to identify SNPs involved in disease symptoms monitor protein translation to diagnose disease
Q: Formic acid is in the venom of some ant species. What is the pH of a 0.5 M solution of formic acid…
A: For weak acids, we can use the equilibrium constant (Ka) and the initial concentration of the acid…
Q: STEM Workplace Practices Q6
A: The objective of the question is to determine whether the optimization of an analytical method is…
Q: The sugar molecules shown below are a) Enantiomers b) Epimers c) Anomers d) Diastereomers
A: Stereoisomers are defined as molecules that have the same molecular formula and sequence of bonded…
Q: A particular reaction has a ΔG‡ of 30.0 kJ mol-1 at 25.0 °C. In the presence of an enzyme, the same…
A: Step 1:
Q: 1. Draw the Fisher projection of D-glucose, and from Fisher to Haworth projection of ẞ-D-glucose.…
A: The configurations of the D-glucose are: R , S , R , RIn β−D−glucose C1 -OH is present on the up…
Q: Tryphtophan is an essential amino acid that is used in the biosynthesis of proteins. Its molecular…
A: Amino acids are biomolecules that have a hydrogen atom, a carboxyl group, an amino group and a…
Q: STEM Workplace Practices Q2
A: The objective of the question is to understand the role of stability testing in ensuring the quality…
Q: Please help me fill out the boxes in this assignment
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Fill in the RNA quantification table below: Sample A260 A280 A260 A280 Concentration (ng/μl)…
A: The conversion factor depends on the type of RNA being quantified.Conversion factors for different…
Q: Create a fishbone diagram for the process of creating an acceptable calibration curve for the…
A: In order to prepare a calibration curve for the spectroscopic determination of rHCA (recombinant…
Q: Q1
A: The objective of this question is to identify and explain three key differences between DNA…
Q: Throughout the electron transport chain many reactions occur. What happens to NADH eventually? ONADH…
A: In terms of hydrogen atom transfer , Oxidation is defined as the reaction in which a substance or a…
Q: STEM Workplace Practices Q3
A: The objective of the question is to understand the purpose of release-testing in the context of…
Q: 11. Quantitative Relationships between Rate Constants to Calculate K, Kinetic Efficiency (kcat/Km)…
A: Kinetic parameters are Km and Vmax. They are used to determine the efficiency of an enzyme. Km is…
Q: C Select the product of the following aldol condensation reaction. a A b B C [] d D e E A H H H B H…
A: Ans: D,EExplanation:Solution:The reactant molecule has two carbonyl groups and the conditions for…
Q: Histone modifications are inherited across ________ but not ________. Question 6 options:…
A: Histone modifications are inherited across mitosis but not meiosis. Histone modifications are…
Q: Which of the following hydrogens is most acidic? a A b B с C 11 1 CH₂ A с
A: Answer: b. BExplanation:On removal of the B proton, a carbanion(conjugate base) will form. Higher…
Q: Question 1: tRNA and amino acyl tRNA synthetases Part a: How many codons encode the amino acid…
A: Methionine is encoded by a single codon, AUG, which also serves as the start codon in protein…
Q: What is the final reaction in the final round of fatty acid synthase? Acetyl-CoA ACP Transacylase…
A: The question is asking about the final reaction in the process of fatty acid synthesis. Fatty acid…
Q: Draw the structure of the isoprenoid biogenic precursor of the terpenes and show the steps in the…
A: Terpenes are unsaturated hydrocarbons produced by conifers (plants). Their general chemical formula…
Q: Reverse translate the sequence of insulin pasted…
A: To reverse translate the given sequence of insulin and optimize the codons for Homo sapiens and…
Q: Based on their fat content, which is the healthier option? Explain your answer. - Based on all of…
A: Unsaturated fatty acids in nature have doube bonds in cis configuration. Vegetable oils have a high…
Q: What makes photorespiration disadvantageous regarding crop yields?
A: "Since you have posted multiple questions, we will provide the solution only to the first question…
Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…
A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…
Q: The peptide below H3N-CH- I NH–CH -NH-CH -NH-CH CH3 CH2 CH2 CH2 CH2 H₂C-CH HỌCH, NH–CH CH2 OH -OH…
A: Peptides are composed of amino acids. Ionizable groups in a peptide are the N-terminal alpha-amino…
Q: (Biochemistry topics: Glycolysis, Citric Acid Cycle, and Electron Transport.) There is a reciprocal…
A: In the reciprocal regulation of glycolytic and gluconeogenic reactions, the interconversion of…
Q: A partial diploid in E. coli is created so that LacI is no longer expressed from the genome and is…
A: Partial diploid E.coli has both chromosomal DNA (i.e. genome) and plasmid DNA, but all the genes are…
Q: You obtained the following raw data when setting up a Biuret standard curve: Absorbancy BSA (mg/ml)…
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: For protein expression, a different strain of Coli is being employed than the one used for plasmid…
A: Approach to finding a solution to the problem:Microbiological, biochemical, and molecular approaches…
Q: Please help me fill in the information
A: Your diagram likely needs labels for the following:Each part of ATP synthase (F_O and F_1 subunits,…
Q: -22 2. (10 pts) Overlapping part of wave function of C-O bond (from to + in x-axis) is expressed by:…
A: The detailed ans has been attached. Explanation:
Q: 4. The interaction of Vitamin D3 with lipid membranes may be studied using different techniques. One…
A: A class of fat-soluble secosteroids is called vitamin D3 .Vitamin D3 is a kind of vitamin D that is…
Q: Give 2 differences between the lagging strand and the leading strand
A: DNA replication is the process by which the double stranded DNA (dsDNA) molecules are copied to…
Q: Provide a schematic representation of the reactions in the beta oxidation of an omega 6 fatty acid…
A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…
Q: You are supplied with the following: / Jy word voorsien van die volgende: NaCl (Mr= 58,443 g /mol)…
A: In order to calculate how much of each component we should use to get the required buffer, we need…
Q: 7. Why proteins prefer to have a-helices or ẞ-sheets in their interior core, instead of random coil…
A: The preference for alpha helices and beta sheets in the interior core of proteins is driven by a…
Q: What is the systematic IUPAC name of the following compound?…
A: for given compound,Option A is correct for systematic IUPAC nomenclature.Explanation:Step 1: In the…
Q: The peptide below is placed into a buffer with a pH = 1.73 H3N-CH- CH2 NH—CH—C H3C-CH NH—CH—C NH—CH-…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: 3. Following are the melting points of 18-carbon fatty acid Stearic acid Oleic acid Linoleic acid 70…
A: The question is asking to determine the number of simple and mixed triacylglycerols that can be…
Q: The following table provides data on three popular protein supplements. (Figures shown correspond to…
A: Let the number of servings of designer whey be 'x' and the number of servings of muscle milk be…
Q: A glucose molecule with its 3rd carbon radiolabelled underwent glycolysis. Which carbon atom in the…
A: During the process of glycolysis, glucose is broken down into pyruvate and energy, producing two…
Q: If the membrane potential of a neuron drops to -55mV and sodium ions start to flow from outside to…
A: Concentration of ion gradients across a membrane and selective movements of ions along gradient…
Q: Write a mechanism describing the conversion of citrate to acetyl CoA and oxaloacetate, catalyzed by…
A: ATP-citrate lyase (ACL) catalyzes the cleavage of citrate using energy from ATP to produce…
Q: I need answer expert solutions please
A: Certainly! Let's break it down:1. Composition: The disaccharide consists of two glucose molecules…
Q: Select the aldol condensation product of the following reaction. a A b B с C d D e E A H HO H NaOH,…
A: Answer: DExplanation:The mechanism:
Q: Write out each of the eight chemical reactions of the citric acid cycle. Draw the structures of the…
A: Citric acid cycle is also called as tricarboxylic acid cycle or Krebs cycle. This is the second…
Q: Question 10
A: The objective of the question is to identify the type of primers used for DNA replication in living…
Q: The kinetic data in the following table were obtained for the reaction of carbon dioxide and water…
A: The substrate affinity of CO2 for carbonic anhydrase or Km is found to be 10 mM.Explanation:Step 1:…
Q: Staphylococcal nuclease has a ΔΔG‡ of -84.1 kJ mol-1 at 25.0 °C. If the uncatalyzed rate is…
A: We know that,ΔG = -RTlnKΔG = change in gibbs energy,when operated at 25 oC = 25 +273 = 298K from…
Q: what is balanced chemical equation for the oxidation of benzoin to benzil using sodium hypochlorite
A: ### Reactants1. **Benzoin**: This is an organic compound with two aromatic rings bonded together…
Step by step
Solved in 2 steps
- generated after a cDNA library is made unique sequences in the genome useful for mapping using sequence information all of the aboveTranscribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may choose than In event, explain choice(s). more one answer. any your I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C>A mutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning. C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation? In your own words, explain your reasoning.
- point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三 囲 Y pre-MRNA:| I囲2 LMatch the term to its best definition. molecule with high-energy bond that carries amino acid to translation site part of a gene that gets translated into a protein primary transcript in eukaryotes that needs to be processed single stranded nucleic acid that helps both in transcription and in splicing nucleic acid that makes up 50% of each ribosome sequence of DNA upstream from the gene that binds RNA polymerase before transcription post processing molecule that carries instructions for making a protein from the nucleus to a ribosome in the cytoplasm part of a gene that gets spliced out during pre mRNA processingQ. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons. A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correct
- Explain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answerRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’a. What is the mRNA transcript of the anticoding strand of the DNA model?Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
- IN A BOND PAPER OR ANY PAPER. CREATE AN INTERACTIVE POSTER ENTITLED "THE CENTRAL DOGMA OF LIFE" SHOWCASING EVERY STEP/PART OF THE CENTRAL DOGMA (REPLICATION-TRANSCRIPTION-TRANSLATION). EXPLAIN WHAT HAPPENS TO A GENE SEQUENCE THAT UNDERGOES TRANSCRIPTION AND EVENTUAL TRANSLATION INTO PROTEIN. (NOTE: YOU MAY CHOOSE A VARIETY OF MEDIUM FOR PRESENTING THE STEPS OF THE PROCESSES.)Explain the steps of translation. Include all molecules involved in the process and their role in the process. Edit View Insert Format Tools TableTranscribing and translating transcribe and translate the following DNA molecules DNA:GCTAGTACGTGCACATTAGAA mRNA: amino acids: