For E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.
Q: Are genes A, D, and E all under the control of operator O? Explain your reasoning
A: Introduction: In E.coli, the structural genes A,D, and E codes for enzymes A,D, and E respectively…
Q: An enzyme isolated from rat liver has 193 amino acids and is and encoded by a 1440 base pair long…
A: Every individual is unique in their own way. This uniqueness is marked by the genes present in them.…
Q: For the lac genotypes shown in the following table, predict whether the structural genes (Z) are…
A: The constitutive expresser of the lac operon in the absence of repressor binding permits…
Q: A glycine residue is in position 210 of the tryptophan synthetase enzyme of wild-type E. coli. If…
A: Single base substitutions in which change in only one base pair occurs.
Q: What will happen if the parts of ubiquitin-conjugating enzymes' parts change specifically the (…
A: Ubiquitin is a 76 amino acid polypeptide that is found in a eukaryotic cell. ubiquitin is served…
Q: Bacillus subtilis is known to harbour proA gene which is expressed as protease. Protease is an…
A: Genetic engineering and bioprocess are very good tools in the pharmaceutical, therapeutics, enzyme…
Q: Why is Molisch's test used for the determination of the presence of pentose in the yeast RNA…
A: Carbohydrates are the polyhydroxy ketones or polyhydroxy aldehydes or their derivatives. In…
Q: Given the following genotypes, explain, by answering the questions in each number, how the mutation…
A: i + p + o + z - y + Complete set of gene products will not be there because z gene that codes for…
Q: In BLOSUM62 matrix, a conserved Tryptophan position has score S(W,W) = 11, but a conserved Leucine…
A: BLOSUM is a block substitution matrix that is used to analyze and identify the best possible…
Q: Briefly describe what primer dimers are, its formation, how it migrates on an agarose gel, and steps…
A: Gel electrophoresis can be referred to as a laboratory technique for separating DNA, RNA, as well as…
Q: Approximately how many nucleotides make up the ATP6 gene? What are the first three nucleotides…
A: Genetic codes are made up of specific nucleotide sequences. Genetic codes are unique for each…
Q: Describe the common strategy (steps) for protein sequencing, starting with a biological sample…
A: Proteins are one of the 4 major biomacromolecules. Proteins are the most abundant of the 4…
Q: For each of the following genotypes, explain how mutation (identified by a (-) will affect the…
A:
Q: A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several…
A: According to the question, we have to mention the strain which has the highest beta-galactosidase…
Q: In the Avery experiment, mice were killed if they injected with S strain cells. Furthermore,…
A: Griffith's experiment, reported in 1928 by Frederick Griffith was the first experiment suggesting…
Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…
A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…
Q: A mutant has no activity for the enzyme isocitrate lyase.Does this result prove that the mutation is…
A: Isocitrate lyase is an enzyme in the glycoxylate cycle that catalyzes the cleavage of isocitrate to…
Q: Higashi et al. (1986) found that three critical mutations were found in one of the two genes coding…
A: The synthesis of RNA from DNA is called as transcription and the synthesis of proteins with the help…
Q: The following polynucleotide was synthesized and used as a template for peptide synthesis in a…
A: The DNA template is used to form an mRNA polynucleotide by the process of transcription. The mRNA…
Q: hy do housekeeping genes have to be hypomethylated and hyperactylated?
A: DNA methylation is a process of adding a methyl group to the cytosine at the C5 position to give…
Q: Which of the following statements regarding Anfinsen's denaturing experiments with ribonuclease A…
A: Anfinsen worked with Ribonuclease A and showed how can the protein be denatured or it can regain its…
Q: A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the…
A: Chromatography is a useful technique to study the separation of amino acids. Paper chromatography is…
Q: Describe how one might determine which protein in E. coli are repressed when a culture is shifted…
A: The Escherichia coli is a facultatively anaerobic, rod-shaped, gram-negative, coliform bacterium.…
Q: You are working with a laboratory strain of E.coli that contains a 10 base-pair deletion in the Lac…
A: The lac operator is the negative regulatory site in the lac operon of E.coli. Here the repressor…
Q: A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several…
A: According to the question, we have to mention the strain which has the highest beta-galactosidase…
Q: Question is attached
A: The lac operon is an Operon or a collection of genes with a single promoter. The genes in the operon…
Q: Given the following phenotypes, explain how the mutation (identified by a (-) superscript) will…
A: Ans: Lactose operon: It is the type of inducible operon in which lactose acts an inducer molecule.…
Q: . Seven E. coli mutants were isolated. The activity ofthe enzyme β-galactosidase produced by cells…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Under what conditions might one expect a deficiency of hypoxan- thine-guanine…
A: The deficiency of HGPRT is due to genetic mutation in the HPRT 1 gene present on X chromosone.
Q: You grow E. coli in defined media containing both glucose and lactose. Draw the trajectory of the…
A: The lac operon It is a set of three genes in E.coli that code for enzymes that help the cell use…
Q: . A geneticist examined the amino acid sequence of aparticular protein in a variety of E. coli…
A: Base substitution is a type of mutation in which a single nucleotide is affected. It is caused by…
Q: What is isosterism and bioisostreism? How does this concept help in biotransformation of different…
A: In biology, drug designing is a major aspect. Drug specificity and effectivity are determined by…
Q: Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after…
A: Introduction- N-terminal methionine cleavage plays an important role in protein synthesis in…
Q: Given that a faulty ribosomal protein is the culprit and causes DBA, discuss the possible role of…
A: The bone marrow does not create sufficient red blood cells to carry oxygen across the body in cases…
Q: Under which conditions would expression of glutamate decarboxylase increase the relative fitness of…
A: The relative fitness of bacteria is defined as the susceptibility of bacteria to adjust, grow and…
Q: What are the conventional and unconventional substrates that are used in Single Cell Protein…
A: According to the question, we have to mention the name of conventional and unconventional substrates…
Q: Given the following phenotypes, explain how the mutation (identified by a (-) superscript) will…
A: And: Phenotype: The observable trait in an organism is referred to as phenotype. In this case…
Q: What is the function of a novel metagenomic alpha/beta-fold esterase? And how does its structures…
A: The alpha/beta-hydrolase fold family of enzymes is quickly establishing a reputation as one of the…
Q: Why do E. coli cells with a defective lacZ gene fail to show galactoside permease activity after the…
A: Galactoside permease also known as Beta-galactoside permease is a protein which is encoded by lacY…
Q: In a mixed copolymer experiment, messages were created witheither 4/5C : 1/5A or 4/5A : 1/5C. These…
A: The genetic code is a system of triple letter codons that are made up of a combination of the…
Q: A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing…
A: The mutants are unable to grow when there is thymidine absent in the growth medium. We can identify…
Q: A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice…
A: Bacteria can be defined as minute living organisms which cannot be visible in naked eyes. These…
Q: For each of the following mutant E. coli strains,plot a 30-minute time course of concentration…
A: Hello! Since you have posted multiple questions, we are answering only one part of the question. If…
Q: Which of these mutations would you predict to be most detrimental? Explain your answer. (Refer to…
A:
Q: Auxotrophic mutation 103 grows on minimal medium supplemented with A, B, or C; mutation 106 grows on…
A: An auxotrophic mutation causes the mutant strain to grow only when a particular supplement is added…
Q: what is isosterism and bioisosterism? how does this concept help in biotransformation of different…
A: The term Pharmacokinetics is used to refers to the measurement of the fate of a pharmacological…
Q: In studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E.…
A: The nitrogenous bases that form the mRNA chain are Adenine (A), Guanine (G), Cytosine (C), and…
Q: For each of the following genotypes, explain how mutation (identified by a (-) will affect the…
A: The operon is the prokaryotic gene regulatory system that regulates the expression of polycistronic…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
For E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- complete steps of haworth projection of D-tagatose(A) strain A strain B pro-Pase protease DOCKING pro-Pase protease SNARES exist as complementary partners that carry out membrane fusions between appropriate ves- icles and their target membranes. In this way, a vesicle with a particular variety of v-SNARE will fuse only with a membrane that carries the complementary t-SNARE. In some instances, however, fusions of identical membranes (homotypic fusions) are known to occur. For example, when a yeast cell forms a bud, vesicles derived from the mother cell's vacuole move into the bud where they fuse with one another to form a new vacuole. These vesicles carry both v-SNARES and t-SNARES. Are both types of SNARES essential for this homotypic fusion event? FUSION Pase (B) 100 75 To test this point, you have developed an ingenious assay for fusion of vacuolar vesicles. You prepare vesicles from two different mutant strains of yeast: strain B has a defective gene for vacuolar alkaline phosphatase (Pase); strain A is defective for the protease…LS1-1 Which of the following best represents the amino acid sequence found in normal adults with the HBB gene? O His, Gly, Asp, Gly, Gin, Leu, Leu Val, His, Leu, Thr, Pro, Glu, Glu O Val, Gly, Asp, Thr, Pro, Glu, Glu O Leu, Glu, Asp, Gly, Gin, Leu, Leu
- Under what conditions will the following partial diploid strain of E. coli convert chorismate to tryptophan (assume trp mutants function similarly to lac mutants)? trpR* trpP trpO* trpE* trpD* trpC* trpB* trpA*/ trpR trpP trpO° trpE trpD trpC trpB trpA ect the one BEST answer (2 oints! O never O only when tryptophan levels are low O constitutively O only when tryptophan is present O only when chorismate levels are lowb. Which one of the following a cell mutants will be able to switch at least once? [Select]GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
- 1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8Genetic Code-Reference Second Letter First Letter C Third Letter UAU] UACS **UAA Stop UGU] Cys UGC U UUU Phe UUC UCU Туг UCC U Ser UUA) Leu UUG **UGA Stop UGG Trp UCA UCG **UAG Stop CUU CCU CAU) CGU His CACJ CAA) CUC CCC CGC Leu Pro Arg CUA ССА CGA A Gln CUG CCG CAGJ CGG AAU] AGUSer U AUU ACU AACAsn AAA Lys AUC Ile ACC AGC C Thr AGA] Arg AUA ACА AAGJLYS GAU] GACASP *AUG Met/Start ACG AGG U GUU GCU GGU Asp GUC GCC GGC Val Ala Gly GAA) Glu GAGJ GUA GCA GGA GUG GCG GGG5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9…