Enzymes act by: a. increasing the activation energy for a reaction b. lowering the activation energy for a reaction c. increasing the free energy of the system d. decreasing the free energy of the system
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: True or False? a. An excess of amino acids can result to the destruction of proteins.
A: The destruction of proteins in cells can occur when due to misfolding and aggregation of proteins…
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: Draw a linear disaccharide of glucose. is an alternating alpha (1-4) and b (1-4) linkages energy…
A: Introduction:- The question is all about the structure of glucose that are isomers of each other as…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: What is the detection principle of iodine test for starch
A: The iodine test is a quantitative analysis of carbohydrates to distinguish polysaccharides from…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: A vitamin is an organic molecule which is an essential micronutrient for organism and are needed…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: for you. If you want a specific question to be answered then please specify the question number or…
Q: A 2x10-6 dilution of your bacterial culture yielded 10 colonies. What was the cell density (in…
A: The purpose of dilution of the bacterial culture before plating is to ensure that the cells are are…
Q: What is enzyme specificity?
A: The metabolic processes involve several metabolic pathways each with several chemical reactions…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: production of Ribose 5-phosphate in the Pentose Phosphate Pathway is needed in the synthesis of…
A: Pentose phosphate pathway, also called the hexose monophosphate shunt or phosphogluconate…
Q: How does 2, 4 Di Nitro Phenol raise human body temperature when used in a weight-loss program?
A: 2,4-Dinitrophenol (DNP) is a yellow, crystalline substance with a sweet, musty odour. It sublimes,…
Q: A 1% by weight agarose gel is typically used in agarose gel electrophoresis. If you used a 2%…
A: During agarose gel electrophoresis, an agarose solution is prepared, it is cooled to prepare a gel,…
Q: if they are true or false? Kindly leave a short explanation. Many thanks! 1. Unlike carbohydrates…
A: A biomolecule, also known as a biological molecule, is one of the many compounds created by cells…
Q: Design a quantitative research experiment to investigate the influence of pH or temperature on the…
A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…
Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot…
A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…
Q: Look at the structure of the disaccharide shown. Name the type of bond which is present. CH2OH H он…
A: Disaccharides exist in more than one chemical conformational structure. The alpha and beta forms of…
Q: When left untreated, very high levels of plasma growth hormone always lead to either gigantism or…
A: 1. True 2. True 3.True(Rarely metastatic)
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: Steroids are biologically four ringed organic compounds that act as important components of cell…
Q: What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA…
A: B. Minisatellites - Micro- and mini-satellites, as well as satellite DNA sequences, account for…
Q: Nutrition Facts Calories 112 Total Fat 0g Total Carbohydrates 21 g Protein 7g What percentage of the…
A: Introduction: Calories are the amount of energy or heat that takes to raise the temperature of one…
Q: Procedure: 1. Dissolve one teaspoon or one packet of active yeast in a small amount of warm water.…
A: Hi, thanks a lot for submitting multiple questions and as you have asked to answer 5, 6 and 7…
Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…
A: Cells are composed of different components, cell organelles and molecules that are responsible for…
Q: Create your own timeline form on biochemistry development and its discovery until today
A: Introduction: The study of the molecular basis of life or understanding the life phenomenon in…
Q: What is the role of the prep phase in glycolysis? To convert G3P molecules into pyruvate and produce…
A: In glycolysis, the glucose molecules are broken down into two molecules of pyruvate along with the…
Q: Calculate the number of ATPATP generated from one saturated 1212‑carbon fatty acid. Assume that each…
A: Fatty acids are broken down through beta-oxidation in mitochondria. The end product of…
Q: HomeExpert Q&AMy answers How is serine related to the activated methyl cycle? Serine’s side chain…
A: Serine is a non-essential amino acid. It is a glucogenic amino acid. Serine undergoes deamination…
Q: Write an equation to describe the catabolism of an aerobic hydrogen oxidizer
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…
A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…
Q: Question 1 -- / 1 Where does molecular oxygen (O2) get generated during photo-phosphorylation? 1…
A: The plants use light energy to convert CO2 and H2O into sugars and oxygen. So, photosynthesis is the…
Q: Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Raffinose is a trisacharide made by three monosacharide units galactose Glucose and fructose.…
Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…
A: One of the factors that determine the solubility of proteins in solution is the concentration of…
Q: What is the dna strand sequence for phosphate sugar backbone?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Give the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle.…
A: The Krebs cycle, or citric acid cycle, occurs in the mitochondrion of a cell. The citric acid cycle…
Q: 1. What are the major functions of lipids?
A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…
Q: Second messenger in regulation of metabolism is: Select one: O a. hormones Оb. АТР neurotransmitters…
A: Secondary Messengers are the molecules that act as amplifying components in the cell signalling and…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Q: Which of the following statements are correct about how the complex biological matrix of the cell…
A: cell matrix or the cytosol is the fluid component of the cell which contains many organelle that…
Q: The purpose of the carbohydrate in the food industry and its frequency of use
A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, with a…
Q: Insulin Glucagon Glycolysis Hexose monophosphate pathway Gluconeogenesis Glycogenolysis
A: Insulin is a hormone made by our pancreas. It controls the amount of glucose in our bloodstream at…
Q: 9. It is noted recurrent vomiting, weakness, sleepiness, and convulsive attacks, as well, in…
A: The ureotelic organisms are the organisms, which convert the ammonia formed through protein…
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which mayonnaise is thicker? Mixing oil to the mixture gradually or mixing all the ingredients in?…
A: Mayonnaise is a condiment used in burgers, salads, and sandwiches. Mayonnaise is considered as a…
Q: Which of the following enzyme catalyzes the first step of glycolysis? Group of answer choices…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…
A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…
Q: 10. Messenger RNA often encodes more that one biological activity. These activities can then be…
A: Introduction: Messenger RNA (mRNA) is a single-stranded RNA that carries hereditary information from…
Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…
A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: 5. A young woman decided to lose weight and abstained from fat-containing food for several months.…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Step by step
Solved in 2 steps
- Instructions: MULTIPLE CHOICE Only choose the correct answer from questions 31 to 36 and no need for an explanation.Please answer all question parts. please make sure to answers the questions (numbered corresponding to the questions and question parts) Thank youInstructions- DO NUMBER 20 AND THE QUESTION DOWN BELOW ON THE PICTURE AND FOR THE QUESTION PLEASE ANSWER IN SHORT ANSWER