ection steps! Which of the following are proper disir ORemove organic matter O Disinfect only O Follow suggested contact time O Mix cleaning products to make the disinfectant more powerful O Disinfect
Q: Briefly describe four ways in which a protein could be denatured.
A: The highly organized structures of proteins are true works of chemical architecture. Denaturation…
Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for…
A: In given Questions many statement given about glycolysis cycle.Glycolysis is the metabolic pathway…
Q: The first 15 bases of the original informational strand of DNA (which continues after what is shown)…
A: Mutation is the change in DNA sequence caused due to various factors. Mutations take place during…
Q: What is the importance of cereal safety
A: Cereal is a major form of food consumed worldwide. Cereals are even considered as the common staple…
Q: write about a Famous Case of someone with Li-Fraumeni Syndrome
A: Li-Fraumeni syndrome is a rare hereditary disorder that predisposes carriers to cancer development.…
Q: 4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Nucleic acids are made up of nucleotides, which are the fundamental building blocks of DNA and RNA.…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Reaction catalyzed by Pyruvate carboxylase is given below; Pyruvate + CO2 + ATP + H2O →Pyruvate…
Q: How does protein form?
A: The Central dogma of molecular biology outlines the steps by which the information encoded in the…
Q: Explanations are not needed. Direct answers are enough. II. True or False a. An effort is…
A: The protein molecules after their folding have exposed patches of charged amino acids on their…
Q: Identifies the roles of ventilation and PCO₂ in acid/base balance . Answer ASAP .
A: Acid is present in body in stomach.Acid and base balence in body is important for human health.Acid…
Q: Km value of an enzyme
A: The study of the rates of enzyme-catalyzed chemical reactions is known as enzyme kinetics. here they…
Q: Sort the electron acceptors that are able to diffuse inside the mitochondrial matrix from those that…
A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport…
Q: The questions ask you to identify which compounds have a specific functional group. For each…
A: Here all the compounds given are organic compounds with Carbon and hydrogen back bone structure. It…
Q: List down the 25 different antibiotics and give the mechanism of action
A: Antibiotics, also known as antibacterials, are medications that either kill or slow the growth of…
Q: Practice 26: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino…
A: Transcription is the process of synthesis of mRNA from DNA. During the translation process, the mRNA…
Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids…
A: Hi! Since you have posted multiple question, we shall answer the first question for as we are only…
Q: Using linear regression analysis, determine the values of Vmax and Km of the enzyme in the ab- sence…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 1. Why is it important in Quantitative Analysis to postpone rounding until the calculation is…
A: A quantitative analysis is performed to detect the amount of specific substance in a sample…
Q: Which of the followingdescribe superior properties of enzymes (biological catalysts) over…
A: Enzymes are biocatalysts that are protein in nature. They Enzymes present a the particular substrate…
Q: Large proteins travel/migrate fast
A: Gel filtration chromatography (GF) isolates proteins purely based on their molecular size.…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: a. What is isoelectric point? (Round your answer to two decimal places, for example: 0.13 or 1.45 or…
A: The isoelectric point (pI) is the pH at which a particular molecule carries no net electrical…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm.…
Q: Differentiate sweet molecules in Column A using the criteria in column B.
A: Given: column A has two components which differs at different aspects as given in column B.
Q: The term rRNA refers to ______ RNA.
A: Ribosomal RNA is abbreviated as rRNA.
Q: Explain when "formulated media" was chosen to be used as a medium in the fermentation process?…
A: A growth medium, also known as a culture media, is a solid, liquid, or semi-solid that is used to…
Q: How does a protein form?
A: Proteins are the heteropolymers of twenty standard amino acids attached together via peptide bonds.…
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: what is the chemistry of nucleosides?
A: Nucleosides are nothing but glycosamines whose analogues are used as anti cancer agents or antiviral…
Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…
A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…
Q: The molecules of a fatty acid (for example, fit closer together than the molecules of a fatty acid…
A: Fatty acids are composed of a long hydrocarbon chain attached to a carboxylic acid group. Fatty…
Q: Calculate the values of the
A: Enzyme kinetics is a study of the rate of enzyme catalyzed reactions. In Michaelis-Menten kinetics,…
Q: What are the main structural features of an amino acid?
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They serves as building…
Q: Most of the ultraviolet absorption of proteins at 280 nm is due to their content of O Tryptophan O…
A: Proteins in solution absorb UV light at 280 and 200 nm, exhibiting absorbance maxima at these…
Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…
A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…
Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…
A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…
Q: Provide one important function of activated APC?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. The overall charge of this protein at pH 7 is Drop-down answer choices are [positive, negative,…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: (a) dues in the polypeptide. Place the label or an arrow on the Ca atom of both residues. Label the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: ACTIVITY 7.2.2 Show and explain how exactly the condensation reaction to form a nucleotide happens.…
A: Nucleotides are the phosphoric acid esters of nucleosides with the phosphate group. Nucleotides are…
Q: Failed to follow
A: When triglycerides are digested and free fatty acids are liberated, the odor is known as hydrolytic…
Q: Match the following structural composition of each polysaccharide with its identity…
A: Polysaccharides, also known as polycarbohydrates, are the most abundant carbohydrates found in food.…
Q: Do we need to denature proteins? Why?
A: Heating, pH fluctuations, high concentrations of chemicals like urea, or reducing agents that break…
Q: 1. What is the effect of increasing the concentration of lactose in the action of the enzyme…
A: "Since you have posted multiple question, we will answer the first question for you. If you want any…
Q: Paracelsus is famous for saying that “all substances are poisons; there is none which is not a…
A: Poisons are chemicals that have the potential to kill. They are chemicals, either man-made or…
Q: GLUCONEOGENESIS Reactant Coenzyme/ Product Cofactor Enzymes
A: The balance between the rate of glucose leaving and entering the blood circulation…
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH2OH C=O…
A: Enzymes catalyse the reaction either by making or breaking the bond. They might form double bonds or…
Q: hat happened to the DNA at the different temperatures (95, 75, 55 degrees)? How does Polymerase…
A: DNA is a double stranded polynucleotide chain ,the double stranded structure is formed by the…
Q: Which of the following chromatographic techniques allows a faster elution of polar proteins? O…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Suggest, which enzyme pathway come into play
A: Phenylalanine is an aromatic and non-polar amino acid, it is both glucogenic (Fumarate) and…
Step by step
Solved in 3 steps
- entic X G Which of the following are prope X elnterface/defaultui/player/modern.html?configuration=&preventRightClick=False&cc=en-US&ieCompatibilityMod.. 2 Orientation to Infection Prevention Exit Which of the following are proper disinfection steps? Check all the apply. O Remove organic matter O Disinfect only O Follow suggested contact time O Mix cleaning products to make the disinfectant more powerful O Disinfect O Disregard the product labels SUBMIT ENG 令中) IN 40 hoWhich of the following surfaces in a resident room should be cleaned and disinfected daily? Please select all that apply. [mark all correct answers] a. Bed rails Ob. Windows O C. Toilets O d. Call buttonsWhat I Can Do? (Character and Creatitty) WORK IN PROGRESS You are tasked to make an alternative disinfectant for corona virus. Which materials are you going to use and why? Explain how this product could promote nationalism and compassion to others.
- t/Root/Pages/TestTaker/MonitorLaunch.aspx?id%3DE9B80AE3-962E-4628-B79D-A3F06F1CAB72 MonitorLaunchaspx?id%3DE9B80AE3-962E-4628-879D-A3F0EFICABT2-Google Chrone uninoculated tube The medium shown here was inoculated with a bacterium then incubated for 48 hours; an uninoculated control tube is also present for comparison. This particular bacterium gave a for this test. a) O negative result b) O positive result c) O indeterminate result Review Later d) O variable resultWhich of the following statements is true about cleaning walls? Multiple Choice 1-Antiseptics should be used first to clean walls if organic matter is present on the walls. 2-Surfaces such as walls should be cleaned prior to using disinfectants or antiseptics. 3-Disinfectants should be used if there are signs of bacterial spore formation on such 4- surfaces. None of the above are true.The Gram-negative Treponema palladium has O lophotrichous flagellar arrangement. peritrichous O endo O monotrichous Ở amphitrichous
- According to CNN, the FDA has a warning list, with over 100 different types of hand sanitizers to avoid. Please mention a few of them and explain why should we avoid them. Also, please provide images if possible. Thank youIdenitfy the statements whether they are TRUE or FALSE 1. You should use P-20 micropipettes to transfer volumes for spread plating. 2. You should use P-200 micropipettes to transfer volumes for pour plating.Name many (more than four) viruses or bacteria a titer not detect even if the patient had already been exposed? (You may need to do a little research)
- True / False Adding a UV disinfector to a pass-through window is NOT offer a higher level a safety for sterile processing personnel.mead. Post Lab #2 Smear & Stain Preparation Name: Leidiawa MontaNo Date: 1. Why are thick or dense smears less likely to provide a good smear preparation for microscopic evaluation? Please explain. Becapse, it will diminish the amount ds latcan Pass through by mam 1t difficult to See under the micioscol e, s less liket to Prowde a go image. 2. What could potentially happen if you leave the slide exposed for too long to the open flame? Why do you have to be careful? we can form ring Patterns if we expose the slide for ta0 the flame 3. During the preparation of a smear leading into simple staining of the bacterial culture S. epidermidis you forgot to heat fix the slide. What would you see on this slide as compared to a slide that was properly prepared? Please explain. 4. You partner stained bacterial cells and saw only the background and not the actual cell was stained. Your partner thought this was a mistake. Please explain what type of staining method this is, how it works and why the…You are given a sputum sample to make serial dilutions on a Friday. The pathologist tells you that the patient is very sick so bacteria should be very concentrated you will need to dilute it (assume that the sample is concentrated at ~1x107 CFUs/mL). But you only have 2 sterile tubes to make dilutions! It is Friday and you want to go home because you are tired and/or want to go have fun with your friends. Since you don’t have time or don’t want to clean and sterilize more tubes to make more dilutions, you decide to make do with the two tubes you have available. How would you dilute your sputum sample to get a countable plate by using only two tubes for dilutions? You have to make sure you get a countable plate. You have to explain your dilutions in detail, this means you need to specify not only dilution factors but the volumes you are using to get to those dilutions.