Answered: Discuss the importance of adding…

Name: Discuss the importance of adding radioactively labeled molecules durin
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Discuss the importance of adding radioactively labeled molecules during 16S ribosomal RNA sequencing process of a bacterial genome.

Science

Biology

Discuss the importance of adding radioactively labeled molecules during 16S ribosomal RNA sequencing process of a bacterial genome.

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’

See similar textbooks

Related questions

Q: scribe the process of cloning a DNA fragment into the EcoR1and AluI sites of the vector pUC18

A: pUC multiple cloning site (MCS) contains lacZ gene which encodes for beta galactosidase (b-gal)…

Q: Starting with a sample of RNA that contains the mRNA for theβ-globin gene, explain how you could…

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: Explain your experimental approach if you must correct the genetic defect phenylketonuria, which is…

A: Phenylketonuria (commonly known as PKU) is an inherited disorder that increases the levels of a…

Q: Discuss how scientists employ a bacteriophagesite-specific recombination system to generateknockin…

A: Knockin mouse is a method in gene recombination in which an exogenous gene of interest is inserted…

Q: ACAACCCCAAGCCTTC

A: Answer : PROBE - DNA probes are the short stretches of single stranded DNA used to detect the…

Q: Explain the origin of the signal that is used in the nucleic acid sequencing method known as…

A: Ion torrent technology is a modern genome sequencing method that converts chemically encoded…

Q: Discuss how recombinant DNA technology has improved the production of the following: Restriction…

A: There are few important points about recombinant DNA technology . Which are as follows . It is also…

Q: The enzymes mentioned below are used as tools during cloning, DNA sequencing and/or gene therapy.…

A: Enzymes Enzymes are the protein that use as catalysts in metabolic and catabolic reaction to fasten…

Q: In CRISPR genome editing technology, when the Cas9 protein cleaves the target DNA sequence, what…

A: The microorganism depends on multiple defense strategies that support them to resist viral attack.…

Q: Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing,…

A: Hi! Thank you for your question. We are answering your question on the basic knowledge of the…

Q: Discuss the use of gel electrophoresis for the separation of macromolecules (DNA, RNA and protein)…

A: Gel Electrophoresis It is a technique which is used to separate the fragment of macromolecules like…

Q: outline HOW to clone and identify a new gene!

A: Gene clonning is technique of genetic engineering where a gene of intrest is isolated from its DNA…

Q: What are the vectors used in rDNA technology? briefly explain each

A: rDNA technology or Recombinant DNA technology is a widely used technology with the advancement of…

Q: Select the definition of a microsatellite. short pieces of DNA surrounding the periphery of the…

A: Answer

Q: Name any two cloning vectors. Describe the features required to facilitate cloning into a vector.

A: Cloning is a process that allows scientists to create perfect genetic duplicates of living…

Q: process of overlap assembly in whole genome sequencing

A: Genome sequencing Genome sequencing or gene sequencing is a way of arranging nucleotides the n the…

Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the…

A: 1.As dd GTP is used, every time it encounters C base it will terminate. 2.When C is encountered with…

Q: Explain why a selectable marker is frequently included in a cloning vector.

A: A cloning vector is a short bit of DNA that may be kept in an organism for a long time and into…

Q: Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes

A: Directional cloning is the technique which is accomplished by cleaving the plasmid vector with two…

Q: Fill the Table with mutagenic agents and provide their type (physical, chemical, biological) and…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: What type of enzymes are used to “cut” desired DNA sequences for use in recombinant gene technology…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: What are the differences between somatic and germline gene editing? Is there any scientific example…

A: Gene therapy is a widely used technique to treat genetic disorders. There are two types of gene…

Q: Compare sequencing method 1 Illumina and sequencing method PacBio for: a. Read length. What are the…

A: Illumina sequencing methods are also called short read methods as they read shorter sequences in a…

Q: Explain and list down the protocols in doing or preparation of materials for polymerase chain…

A: Polymerase chain reaction (PCR) It is an in vitro technique that takes a specific sequence of DNA…

Q: Identify which mutagen is described by the following statement. Inserts between adjacent bases in…

A: Certain chemical mutagen can insert between adjacent base pairs of DNA molecule e.g., proflavine…

Q: has been assembled by researchers and transplanted into a donor bacterial strain to study never…

A: A- recombinant plasmid B- developmental genetics

Q: Please answer ASAP RNA sequencing (RNA-Seq) of one sample in one run of a massively parallel…

A: Next-generation sequencing (NGS) is a massively parallel sequencing technology that offers…

Q: Refer to the figure. What method would you use if you wanted to determine the sequence of the cDNA…

A: cDNA is complementary DNA. This DNA is artificially synthesized from the mRNA template. In genetic…

Q: Consider the following human genetic diseases: hemophilia, Down syndrome, cystic fibrosis, and brain…

A: CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) Cas genome editing technology…

Q: Discuss the main similarities and differences in the nucleic acid sequencing methods known as…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Describe the features of a typical CRISPR locus in a bacterial cell.

A: CRISPR (short for clustered regularly interspaced short palindromic repeat) acts as the immune…

Q: Use this information to match the list of probes to the 3 samples below: You have isolated several…

A: Southern blotting and Northern blotting are used to isolate and identify nucleic acid present in the…

Q: Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite…

A: Transposons are DNA (deoxyribonucleic acid) segments that have the internal property of movement…

Q: Consider the reagents required to perform CRISPR genome editing, Which molecule specifies the a new…

A: CRISPR genome editing is a genetic engineering technology in which the genomes of individual are…

Q: Describe how to select recombinant clones if a foreign DNA is inserted into the polylinker site of…

A: Introuction- pUC18 is a 2686 bps long plasmid vector which contains pMB1 as origin of replication…

Q: the strategies commonly used to detect for a named cloned gene in E.coli

A: Gene cloning, otherwise known as molecular cloning, alludes to the manner toward confining a polymer…

Q: The best molecular technique to quantify the gene transcripts is (write in fu!!).

A: The Central Dogma concept states that "DNA makes RNA and RNA makes protein". This concept is…

Q: Briefly explain why RNA-seq gives more information about the transcriptome than does microarray…

A: Messenger (m-RNA) ribonucleic acid is known to be transcribed from the DNA molecule, which is the…

Q: CRISPR RNA (crRNA) in a bacterial cell: is a snippet of genetic material from a virus stored in a…

A: The CRISPR/Cas9 or clustered regularly interspaced short palindromic repeats and CRISPR-associated…

Q: Assume you have successfully cloned a small (200 bp) fragment of DNA into the polylinker region of a…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Describe the process of cloning a DNA fragment into the EcoRI site of the Charon 4 vector. by…

A: Cloning is a procedure to make several identical copies of a DNA (Deoxyribonucleic acid). Charon 4…

Q: To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are…

A: A Coverage is multiplier based on total size of the genome. Formula = Coverage = (read length) x…

Q: Review DNA sequencing and cloning tools. Match term and its description. a cloning vector that…

A: A cloning vector that contain a highly active bacterial promoter is called the expression vector .…

Q: What size bands would you expect to see on the Southern blots using probe 1 and probe 2 for an…

A: Introduction The term Sickle cell disease defines the condition where due to a mutation, the blood…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

Discuss the importance of adding radioactively labeled molecules during 16S ribosomal RNA sequencing process of a bacterial genome.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
In bacterial transformation, the purpose of having antibiotic within an agar plate is to: Select one: confirm which plasmids been have successfully ligated with a gene of interest. isolate bacteria which have been successfully transformed with the plasmid. indicate which plasmids were successfully digested by the endonuclease. act as a substrate which will be cleaved and produce a blue product when ligation is unsuccessful. show which plasmids contain the lacZ gene.
A) Outline the experimental procedure for cloning a eukaryotic gene and expressing it in E. coli. Focus on the essential steps starting with eukaryotic gene amplification to transformation of E. coli cells B) Explain how insertional inactivation can help you identify the colonies that carry the plasmid with your eukaryotic gene of interest C) Plasmids containing antibiotic resistance genes are widely used in gene cloning and other molecular biology techniques. What would happen if the eukaryotic gene was inserted into an antibiotic resistance gene on the plasmid?
List the critical steps in the ribosome profiling protocol and explain what this method is useful for when coupled with high-throughput sequencing.
Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGAC
Describe the automated dideoxy chain termination method of DNA sequencing.
Ihsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Ihsan finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.
Using a ThermoFisher GeneJet Miniprep plasmid isolation kit to isolate plasmids from bacteria: Use of RNAse increases purity of purified plasmids. This enzyme will be added when the cells are lysed, detroying all RNA in the sample. Why will this action increase the purity of an isolated plasmid sample? This will only be used for the plasmids isolated using the GeneJet purification columns, and not when performing alkaline lysis. How will this affect the predicted results for the alkaline lysis plasmid isolations?
It is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?
Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…
Bacteriophage lambda is as one of the routinely used molecular cloning vectors, which alsoserved as a model system for the study of bacteriophage morphogenesis, DNA replication, andgene regulation.a) With the aid of a diagram, generally narrate how a foreign gene can be inserted into alambda insertion vector and subsequently infect an Escherichia coli cell.b) You are cloning a 7.5 kb gene into a lambda gt10 vector, utilizing a restriction site whichspecifically present in the vector. State the restriction site that you can use for this purposeand suggest a screening procedure to indicate successful integration of the gene into thehost genome.
In regards to using PCR: Explain why a plasmid is often engineered with tetR and lacZ. What purpose do they serve?