Q: Do you think some ingrediants in foods, that prolong the life of that food, make it easier or harder…
A: Preservatives: Preservatives are substances added to food and other products to prevent spoilage,…
Q: Observed Genotypes A1A1 10 A1A2 20 A2A2 20 1. According to the table above, what is the observed…
A: Hardy-Weinberg principle: The Hardy-Weinberg principle, also known as the Hardy-Weinberg…
Q: Describe the microbial cell cycle and how it impacts industrial uses of microbes. Describe the…
A: As per bartleby guidelines only 3 subparts can be answered. Please post remaining questions…
Q: The three beetle species live in the same ecosystem, and they likely evolved from the ancestral…
A: Introduction: The process of speciation is how one species eventually divides into two or more…
Q: Biological evolution is best defined as A. the process of direct observation B. unchanging nature of…
A: Biological Evolution: Biological evolution refers to the process by which species of organisms…
Q: An example is flower color in Mendel's experiments Always controlled by many genes and can be…
A: Continuous Traits: Continuous traits are traits that exhibit a range of phenotypic values, with…
Q: Compute for the appropriate amount (mL_) of the compositions of a 10 mL 2x CTAB buffer for DNA…
A: DNA extraction is a process of isolating DNA molecules from cells, tissues, or biological samples…
Q: Which among the groups would be affected when the pH is 6.5, and what antibiotic panel will be…
A: The pH of the agar medium can influence the solubility, diffusion, and bioavailability of…
Q: We are required to create a certain topic on our Evolutionary Biology class. And the topic is what i…
A: Antibiotic resistance evolution facilitated by a concentration gradient is a complex and concerning…
Q: DNA polymerases add a deoxyribonucleotide triphosphate to the 5' hydroxyl group of a growing DNA…
A: DNA replication is the process by which a cell makes an identical copy of its DNA before cell…
Q: Muscle contraction is the biomechanical process of: Ostretching elastic elements to produce force…
A: Introduction Muscle contraction is a physiological process that involves the activation of muscle…
Q: Describe the general structure of all cell membranes. How does this membrane structure determine the…
A: Introduction The cell membrane, also known as the plasma membrane, is a thin, semi-permeable…
Q: Describe the parasitic cycles of worms, including roundworms, flukes, and tapeworms.
A: A parasitic life cycle refers to the series of stages that a parasitic organism goes through in…
Q: Field Data Summary 29 6 4 5 dd 3 Collecting Site 1 2 Substrate Color Light Light Dark Dark Dark…
A: In rock pocket mice , coloration of fur is polygenic trait and colour ranges from very dark to light…
Q: Prepare a Punnet square, genotype, and pedigree analysis for the given pedigree chart
A: A Punnett square is a tool used in genetics to estimate the likelihood that a child would acquire a…
Q: Look at the nutrition labels for a Blueberry Nutrigrain Bar and a Blueberry RX Bar, also paying…
A: By examining their nutrition labels and ingredient lists, we can gain insights into the differences…
Q: Part 3 Use your calculations from parts 1 and 2 to determine how many of the 400 offspring will be…
A: The distribution of genes on chromosomes and the interactions between alleles are two examples of…
Q: What are the different types of ecological relationships between organisms in an ecosystem?
A: Introduction: Ecology is the scientific study of the relationships between organisms and their…
Q: The image shows a lipid bilayer, with the polar heads represented by circles and the hydrophobic…
A: Introduction Phospholipids are a type of lipid molecule that are essential building blocks of all…
Q: How can we measure gene flow between discrete populations? a. By estimating the proportion of…
A: The transfer of genetic variation from one population to another via the movement of individuals or…
Q: 1) During anaphase, Kinesin-13 proteins are localized at the kinetochore (A1) and the spindle pole…
A: Microtubules are thin, cylindrical structures composed of tubulin protein subunits. They are…
Q: Compare the relative abundance of microbial growth on the agar surface touched by unwashed and…
A: Microbial growth is the increase in the number of microorganisms in a specific environment or…
Q: What are two types of weak molecular bonds? Then, describe two examples of how these types of weak…
A: Introduction : Hydrogen bonding : A hydrogen (H) atom covalently linked to a highly electronegative…
Q: What are the 3 pigments that absorb visible light for photosynthesis? Which part of visible light do…
A: Pigments are molecules that absorb certain wavelengths of visible light and reflect or transmit…
Q: If you wanted to use the molecular clock to estimate times of divergence for phylogenetically…
A: Introduction: A gene is a segment of DNA that contains the instructions for the development,…
Q: How is a phylogenetic bootstrap value calculated?
A: The phylogenetic bootstrap is a statistical technique used to evaluate the reliability of nodes in a…
Q: During cell respiration, what happens to the strength of the bonds between atoms in glucose vs those…
A: The process by which cells convert glucose into energy in the form of ATP is known as cellular…
Q: Describe a typical neuron. Then describe 3 features of neurons that allow for electrical…
A: Neurons are the functional unit of nervous system that are responsible for generation and conduction…
Q: INTERPRETING ECOLOGICAL DATA Graph 1: Rabbits Over Time a. The graph shows a b. The carrying…
A: Introduction : The two factors used to evaluate a country's population growth are the birth rate…
Q: Case / Project B The Sacramento County Coroner's Office recently recovered skeletonized remains that…
A: Humans are a species of bipedal primates belonging to the genus Homo and the family Hominidae. They…
Q: THIS IS A 2 PART Question a. Is this a good streak? If so, explain why. If not, explain what you…
A: Streaking is a microbiology technique for isolating single colonies of microorganisms from a mixed…
Q: What morphological and anatomical characteristics can you use to distinguish roots from stems from…
A: Introduction Morphological characteristics are physical features that are visible to the naked eye…
Q: You found a bright blue growth on a tomato you had left on your kitchen counter. You’ve never seen a…
A: Introduction A hypothesis is a proposed explanation for a phenomenon or observation that can be…
Q: glands are devired from which gland?
A: Gland is a group of tissues that is an organ that are specialised for the secretion of substances…
Q: The trophozoite stage of Entamoeba histolytica is the active, feeding stage of the parasite. It is…
A: Introduction Entamoeba histolytica is a protozoan parasite that can infect humans and cause a…
Q: What is the purpose of using an outgroup when reconstructing a phylogenetic tree? [at least mention…
A: Introduction A phylogenetic tree is a diagram that represents the evolutionary relationships among…
Q: Give typed explanation The provider orders a maintenance dose of Magnesium Sulfate 1(g)/(h) to be…
A: This question involves calculating the maintenance dose rate for Magnesium Sulfate, a medication…
Q: 1 Can you make a model that shows how blue eyes originated? Can you include genes, chromosomes,…
A: The OCA2 gene, which controls the synthesis of melanin in the eye's iris, is the hereditary source…
Q: What arethe three main checkpoints involved for both Mitosis, and Meiosis 1?
A: Cell cycle is a set of events that occur in a cell when it divides and grows. A checkpoint is one of…
Q: Topic: Flagellates Giardia lamblia trophozoite is described as “old man with glasses”. What are the…
A: Introduction: Flagella are long, whip-like structures that protrude from the surface of cells and…
Q: Answer the following question briefly but concisely 1. What are the similarities and differences…
A: Magnetosomes are specialized structures found in some bacteria, particularly magnetotactic bacteria,…
Q: 2. Describe the technique of immunocytochemistry and give an example of a specific cellular…
A: An antibody, also known as an immunoglobulin, is a protein molecule produced by the immune system in…
Q: (c) Based on the primary sequence surrounding the transmembrane portion, predict which Portion would…
A: The chemical structure of the 5-HT 2A receptor and its interactions with psilocybin and psilocin are…
Q: An in-class test of the opponent process theory of color vision relied on a basic principle of…
A: Color vision theory is a scientific explanation for how the human eye and brain perceive and process…
Q: How may nanotechnology help in the fight against sickness and its treatment? In what other ways…
A: Introduction Nanotechnology is the science, engineering, and application of materials and devices…
Q: 6. There are many ways to categorize the different local threats to corals. Now that you know more…
A: Corals: Corals are marine invertebrates that belong to the phylum Cnidaria and class Anthozoa. They…
Q: How far each bands has run for A and B compared to that dye front ?
A: Electrophoresis is a laboratory technique used to separate DNA fragments based on their size and…
Q: Clinical trials to prevent activation and invasion of cancer metastasis, explain where they are in…
A: Clinical trials to prevent cancer metastasis are ongoing and showing promising results. Metastasis…
Q: 3. Which symbols would you use to represent the genotype of an individual who is lactose tolerant?…
A: Introduction Genetics is a branch of science which deals with the study of gene and inheritance.…
Q: electron transport chain
A: Cellular respiration: It is defined as the process by which the organisms combine the oxygen with…
Did the authors discover any microbes present that should be cause for concern, in your opinion (and why)?
i need the answer from the article please
https://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-018-1323-4
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Help me, please! I wish I have a lot of time to do it by myself ... This is the article link and a microbiology open Stax book link for chapter 16 terms. Please help me to find answers. https://piercemil.instructure.com/courses/2180982/assignments/24927088 https://openstax.org/books/microbiology/pages/15-2-how-pathogens-cause-disease#OSC_Microbio_15_02_Invasion Questions: If possible please write the pg of an article with related Answers; it will be easier for me to describe in detail. Thank You for Helping me. Using the terms found in the “Patterns of Incidence” subsection in Chapter 16, what pattern of incidence best matches the outbreak described in the article? Using the terms found in the “Pioneers of Epidemiology” subsection in Chapter 16, which discusses “spread”, what type of spread of the pathogen best matches the outbreak described in the article? Be specific. What type of epidemiological study was used to identify the source of the pathogen in the article? Be specific.…can you explain why Bacillus anthracis can be pathogenic in a mouse and not be fought off by the immune system? I need help finding the answer in the article and explain in short answer link to article: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/I need help answering this question to my professor: The topic for the discussion was this one: Some potentially pathogenic bacteria and fungi, including strains of Enterococcus, Staphylococcus, Candida, and Aspergillus, can survive for one to three months on a variety of materials found in hospitals, including scrub suits, lab coats, plastic aprons, and computer keyboards. What can hospital personnel do to reduce the spread of these pathogens? My answer was this one: To reduce the spread of these pathogens an infection control protocol should be followed. Some ways in which this could be reduced is by using desinfectants, sterilization, hand washing, and disposing techniques. In addition, I currently work as a dental assistant at Jackson Main and the protocol we use is hand washing our hands for at least 20 seconds before and after seeing every patient. We use CaviWipes to disinfect every surface and autoclave every single instrument after every use. Also, we make sure to…
- What are three public health measures that could reduce the probability that bacteria will develop resistance to antibiotics? Be specific in your description, and remember to include evidence to support your answer. write a brief paragraph for each one of them. Be sure to include links / citations / references to support your answers.go to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…Question 16 Within the context of infectious disease, which of the following specimens would be considered irretrievable? Question 16 options: a) Wound swab b) Blood sample for therapeutic drug monitoring c) Cerebrospinal fluid d) Urine sample
- This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acidsidentify a Researcher or Company that helped with creating the treatment for pathogens. Please give me a Pathogen that was treated. Please include references used.My professor instructed me to make presentation on this topic "Periodontal microbes interaction with FISH". I have to make 4 power point slides regarding this topic. Can you give some information about the topic which i can use in the slides? Also provide some necessary relevant diagram or image regarding the topic. Please answer at your own easy words. If you do so i will rate you positive, Thank you.
- Anthrax-laced letters were sent to the Senior Librarian recently. After the building was evacuated and all of the potentially exposed workers had received antibiotics to prevent the establishment of infection, no one was sure how to disinfect the building to make it safe for the return of workers. Your team has been hired by the Management to develop a plan to decontaminate the Building Complex after the arrival of anthrax-laced letters. The Building Complex contains thousands of valuable documents that cannot be destroyed. Workers need to be able to return to the buildings, although they do not need to return immediately. You need to guarantee the safety of workers who return. a. Can you devise an experimental setting to test the effectiveness of your strategy?b. What advice would you give to workers concerned with contaminating their family members?What is an introduction to immunology and immunopathology? How would you summarize this to someone who is new to this? https://aacijournal.biomedcentral.com/articles/10.1186/s13223-018-0278-1I need help answering this queshtion based on the answer in the article you are whitin a bacterium travelling from the outside of a Gouda wheel through the rind and into the core. What can you say about the chemical environment of the areas you pass through? https://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-018-1323-4