Describe the importance of biodiversity.

Q: For each of the following genotypes, explain how mutation (identified by a (-) will affect the organ...

A: The operon is the prokaryotic gene regulatory system that regulates the expression of polycistronic ...

Q: What effect does the amount of trunk flexion and barbell placement have on the knee and hip muscles ...

A: Answer 

Q: Is there a connection between the regeneration of fish scales to its survival? If there is, then wha...

A: Regeneration:- Many different parts of the fish’s body will grow back. Plucked scales are promptly r...

Q: oniferous tree A. bears leaves B. sheds leaves annually C. has cones and needles  D. changes wi

A: Our earth is full of biodiversity. Every days with encounters with different types of organisms such...

Q: What is one statement that would support the theory that all organisms are related? A) The genetic...

A: In addition to being degenerate, the genetic code is also called to as 'unambiguous,' implying so ea...

Q: Explain the roles of sensory nerves in how do humans receive odors and scents?

A: The olfactory epithelium is a strip of tissue at the back of the nose that contains millions of sens...

Q: A

A: Liverwort:  Hepatics or liverworts are a division of non-vascular terrestrial plants known as the Ma...

Q: Base on your own opinion, what does genetics mean? What is its relationship to all living things? ...

A: Term genetics was given by William Bateson. Gregor Mendel is known as father of genetics.   *Only fi...

Q: The area of cancer research is always evolving. Research one type of new therapy and write in your o...

A: Cancer one of the deadliest disease which has a high recurrence rate even after the initial stage de...

Q: 4. The symptoms of many viruses come and go within 24 h. Use viral replication information t explain...

A: Viruses: A virus is a made up of protein and nucleic acid. It is submicroscopic infectious agent tha...

Q: While performing a routine protein crystallization screening, you observe that one of your well drop...

A: Introduction The drop on the elevated platform, which is usually 2–10 µl, consists of half stock pro...

Q: Regarding mammals, amphibians, and reptiles, explain thoroughly in what way does the inert yolk's ma...

A: Evolutionary developmental biology is considered a new norm in evolutionary biology. It arose from t...

Q: Explain the purpose of the regulations on DNA technology.  (Give 4 points)

A: Purpose Of The Regulation On DNA Technology --- Biotechnology -- Advancement in the technology is ve...

Q: How is artificial selection different from Darwin's idea of natural selection?

A: The theory of natural selection was explored by 19th-century naturalist Charles Darwin. 

Q: In the diagram below, the letter B represents: d. a The substrate specific for the enzyme The active...

A:

Q: What kind of medicine is used to treat ringworm. Is this medicine synthetic or was it isolated from ...

A: Given: Ringworm is caused by the fungus that eats keratin. These are called dermatophytes. They atta...

Q: From the previous question regarding the insertion of an A base into the template strand: will this ...

A: The transcription is the process of RNA synthesis from the DNA template. It is the first step of gen...

Q: What is the probability that we can exclude a father as the true parent

A: Answer a. The probability that a father can be excluded as a parent is 0.1344 Answer b. Because here...

Q: Give at least four types of food processing and explain its processes and applications.

A: Food Processing modification or changes to a plant or animal product after harvesting.  Types of Foo...

Q: Explain the role of isotype exclusion in pro-B cells.

A: Introduction:- In a given lymphocyte, either κ or λ light (L) chain, but not both, can combine with ...

Q: Describe the differences among embryonic, adult, and induced pluripotent stem cells.

A: Stem cells Stem cells are those cells that have the capacity of self renewal and differentiation. S...

Q: In the space below, draw, color, and label one of the respiratory system models that you examined. I...

A: Respiratory system is concerned with the the taking in of Oxygen and Carbon dioxide outside. It is c...

Q: RNA information. below. Parent DNA ATG-AAT-TCG-TAC-AG Replication Transcription Translation

A: The DNA is the genetic material that can inherited from parents to offspring. It contain the genes t...

Q: Difference in the structure of eukaryotic and prokaryotic cells. Provide example for each. You may d...

A:

Q: A cross between fruit files with genotypes Aa Bb × aa bb produces the following progeny: 10 Aa Bb 4...

A: In a cross, the arrangement of linked alleles on the chromosomes is critical for determining the out...

Q: The force causing air to flow into the lungs during ventilation is: Decreased lung pressure Increase...

A: Air flows inside and outside the lungs die to the pressure difference in atmosphere and inside lungs...

Q: II. Answer the following: 1. What does NADPH do? 2. In the Krebs cycle, isocitrate releases a molecu...

A: Introduction :- The tricarboxylic acid (TCA) cycle, commonly known as the Krebs or citric acid cycle...

Q: I learned that the base pairs for DNA are and and the base pair of RNA are and I learned that togeth...

A: Introduction:- Under normal circumstances, the nitrogen-containing bases adenine (A) and thymine (T)...

Q: Which type of virus must contain an RNA replicase packaged in the viral particle in order to carry o...

A: A virus is a small collection of genetic code, it can be  DNA or RNA, surrounded by a protein coat ,...

Q: What is diffusion

A: Introduction :- Diffusion is a process that occurs as a result of random molecular mobility and resu...

Q: Study the following scenario. Plot the 5-day menstrual dates in the calendar provided in the activit...

A: Menstruation is a 3-5-day period in which a bloody fluid containing endometrial cells, glandular sec...

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: Introduction A cell's ability to receive, process, and transmit messages with its surroundings and w...

Q: How does application of recombinant DNA influenced the way in today's life? Answer comprehensively

A: Recombinant DNA technology is an important development in science that has made human life much easi...

Q: Which of the following is not a phenotypic description of allele interactions affecting the expressi...

A: Answer1- option D. Multifactorial

Q: No more than five sentences provide the SWOT analysis on plant based calcium sources. pick a calcium...

A: SWOT analysis is a strategic management technique used to help a person or organization to identify ...

Q: Template strand: 5'.GTCTCTTGACATTG... 3' if the nucleotide highlighted in yellow is mutated to a C, ...

A: In silent mutation , if one nucleotide chaged or mutated then codon become changed but no effect on ...

Q: Which o f the following will drastically increase resistance of blood flow?       1000 miles of blo...

A: Ans)If we took all the blood vessels out of an average child and laid them out in one line, the line...

Q: a paragraph, describe the feedback mechanism that happens in the femaile reproductive system

A: Answer 

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: Construct a single triglyceride molecule by the process of dehydration synthesis

A: Triglycidyl or TAG is trimesters of fatty acid and glycerol. 2 types - simple and mixed. Those that ...

Q: How would you test an ecological hypothesis about endangerment of animals due to deforestation

A: Ecological factors associated with wild animals are harsher climate, temperature, luminance, moonlig...

Q: DNA technology in medicine can reduce human suffering by:

A: DNA technology is an advanced technology that is applied in medicine whether in detection of the dis...

Q: Most of the energy during x-ray generation is transferred from kinetic energy (the high-speed electr...

A: X ray generation takes place in x ray tube.The 99% of the kinetic energy is transferred into heat an...

Q: Tetracyclines are another kind of antibiotics that are made by fungi. They work by inhibiting transl...

A: Most of the microbes release some secondary metabolites;which are not required for their growth and ...

Q: E. coli cells have peritrichous flagella. What does this mean?

A: Escherichia Coli, also referred as E.coli, is the rod-shaped, gram negative bacterium. It generally ...

Q: Stem length in plants is controlled by two CODOMINANT alleles of one autosomal - one allele, B, adds...

A: 1-If the breeder starts crossing with two heterozygotes (Bb), then their initial lenghts would be (=...

Q: What's More Activity 2.1 Concept Map Directions: Fill in the concept map of the important events in ...

A: Introduction :- A woman's body undergoes a variety of changes each month between adolescence and men...

Q: Study the following scenario. Plot the 5-day menstrual dates in the calendar provided in the activit...

A: Let's assume first day of periods is 1 October (as you didn't mention in question). It's five day cy...

Q: what are the factors affecting visual perception of humans?

A: Visual perception is the ability to interpret the surrounding environment through photopic vision (d...

Q: can you explain me this slides how  to identify and labeled them

A: ANSWER;- The picture is the slide to identify and label them;-

Conservation Biology

The study of how to prevent the loss of biological diversity on the planet is called conservation. Biological diversity, also termed biodiversity, consists of various life forms found in a specific location or across the entire planet, including ecosystems, species, populations, and genes. Conservation thus aims to protect the diversity of life at all levels of biological organization.