Consider two proteins with a pl. of 4.5 and pl. of 7.7? Using a cation-exchange column, describe how these two proteins could be separated. Indicate which buffer you would prepare and how a salt gradient may be employed.
Q: ) Describe the 10 enzymatic reactions of glycolysis and the organization of the pathway in 2 main…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: What is an engineered plasmid used for? What are the important features of\ engineered plasmids?
A: Engineered plasmids are powerful tools that allow researchers to manipulate DNA sequences and study…
Q: Consider the same hypothesis: Bone cells treated with vitamin D generate an increased amount of bone…
A: 1 This hypothesis is an alternative directional hypothesis.It states that bone cells treated with…
Q: 1. Hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase is 99% complete at…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: Part A. Weight of skimmed milk Isolation of Casein Weight of dried casein Percentage casein in…
A: Since you have posted multiple questions, we will provide the solution only to the specified sub…
Q: Why are hydrogenases oxygen sensitive? Consult Morra, S. (2022), Fantastic [FeFe] Hydrogenases and…
A: Hydrogenases are enzymes that catalyze the oxidation and reduction of molecular hydrogen. They play…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: Serine, histidine, and aspartate all are amino acids. They all have different properties and…
Q: Pls send solution fast within 10 minutes and i will give like for sure Solution must be in typed…
A: a) The total binding constant, K, is the product of the individual binding constants K1 and K2: K =…
Q: Buffers in pharmaceutical and biological systems
A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…
Q: Using the cultured cells used in this experiment and described in the introduction, how would you…
A: When increasing amounts of the labelled ligand are added to the cells, the amount of binding will…
Q: What is test for carbohydrates and why is it important?
A: Introduction. There are four different types of biomolecules present in our body, carbohydrate,…
Q: (ii) Shown below is a section of a canonical TFO. Discuss, in detail, chemical modifications that…
A: Triplex forming oligonucleotides (TFO) are single stranded homopyrimidine/homopurine oligonucleotide…
Q: If a specimen contains 30% adenine in its DNA, how much cytosine will it contain? O 40% O 30% O 20%…
A: The biological macromolecule DNA that contains the genetic information responsible for the…
Q: 1. Discuss the 2 mechanisms by which Chloride maintains electrical neutrality.
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Why does casein precipitates upon the addition of acetic acid? Why is milk used as an antidote in…
A: Proteins are primarily composed of one or more polypeptide chains. Every polypeptide chain is a…
Q: Draw two ringed a-D glucose monomers forming a disaccharide (maltose). Make sure to label the…
A: Glucose is a 6 carbon containing aldose sugar i.e. it is an aldohexose. The most stable ring form of…
Q: 1. Describe how each of the following modes of analysis may be used to measure enzyme activity:…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: List the similarities and differences between the followinv coenzymes in terms of structure and…
A: Coenzymes are organic compounds with part of vitamins in the structure, required for the functioning…
Q: Draw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen…
A: Guanine is a nucleotide base found in nucleic acids like DNA and RNA . It pairs with Cytosine with…
Q: 5 When your body metabolizes fat for energy, it gets 9 Cal./g, as opposed to only 4 Cal./g from…
A: Adipose tissue is a type of connective tissue which comprises fat cells, or adipocytes, which store…
Q: Consider the following α helix from myoglobin at pH 7.…
A: Proteins are folded polypeptides. Polypeptides are amino acid polymers linked to each other via a…
Q: 1.2 Ninhydrin Test Substance 2% glycine 2% gelatin 2% albumin 1% tyrosine casein + distilled water…
A: Ninhydrin test : It is the alpha-amino groups in proteins and amino acids that are responsible for…
Q: Consider a peptide with the sequence Ala-Glu-Arg-Leu. Assume the ionizable groups have the pKa…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: On a single graph, sketch a qualitative velocity profile (velocity vs. time) for the enzymatic…
A: Activity of an enzyme is the amount of product produced per time. Relative activity of an enzyme is…
Q: Draw the resonance structure of a tripeptide peptide backbone, indicating the N- and C-terminal and…
A: Peptides are molecules composed of amino acids joined together through peptide bonds. The peptide…
Q: In terms of organism, location and function, what are the major differences between nuclear and…
A: DNA is deoxy ribo nucleic acid. It is a hereditary material and can store genetic information. This…
Q: Name of Enzyme Class Number of Enzyme Reaction Catalysed Hexokinase Phosphorylates glucose…
A: Glycolysis is a pathway that converts glucose molecules into energy by breaking into pyruvate…
Q: Why was it necessary to use phosphoaminophosphonic acid-adenylate ester (ANP) in the ATP synthase…
A: As per the chemiosmotic Model, ATP synthase is the enzyme that phosphorylates ADP with Pi as…
Q: Calculate length of tubes required for desired production rate
A: Proteins Proteins are the long chain of amino acids , they are essential for the structure,…
Q: OH HO "OH Enzyme A 0= отва OH OH HO OH
A: Glycolysis is a metabolic pathway that converts glucose into pyruvate. The site of this metabolism…
Q: n a-c below, will the residue on the right-hand side increase or decrease the pKa of the residue on…
A: Amino acids that do not have ionisable side chains are zwitterion at neutral pH since they have an…
Q: tate and define the four levels of protein structure, also include the bonds found at each level?
A: Introduction Proteins are the most abundant macromolecules in our body. Proteins are made up of…
Q: Question 2 - Which of the following is required for import of mitochondrial matrix proteins? (select…
A: Most of the enzymes and other proteins required by mitochondria is encoded by the nucleus, despite…
Q: Some types of tumors express cell-surface receptors that are specific for unique peptide sequences.…
A: Of these 9 amino acids, 7 amino acids(H,W,S,Y,L,P,G) will be carrying a positive charge at pH 4. At…
Q: T F T F T F T T F F T F T F Vmax is the velocity observed when all of the enzyme present is fully…
A: The kinetics of an enzyme-catalyzed reaction can be described using a variety of parameters,…
Q: Consider the amino acid aspartic acid for this problem. Aspartic acid can be considered a triprotic…
A: Aspartic acid have 3 ionizable groups in it. They are; alpha- carboxyl group alpha-amino group…
Q: True or False: The side chain of glutamate can form an ionic bond at pH 1. True False
A: Glutamate is an α-amino acid that is commonly found in proteins.The amino acid has a side chain…
Q: Identify what GalNAc, GlcNAc, Frutose and Sialic Acid are, draw them and describe their…
A: Carbohydrates chemically are polyhydroxy aldehydes or ketones. They serve diverse function roles…
Q: The AG of a reaction is positive. Which is TRUE? The cell cannot catalyze this reaction under any…
A: In a general reaction such as: A + B ⇌ C + D At equilibrium (steady state), the concentration of…
Q: Given this short polypeptide: Met-Ala-Gly-Ser A) Which is the amino terminal amino acid? B) How many…
A: Proteins are folded polypeptides. Peptides are polymers of amino acid residues linked via a peptide…
Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…
A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…
Q: Production of a recombinant protein by E. coli is proportional to cell growth. Ammonia is used as a…
A: Recombinant proteins are proteins that are produced through genetic engineering. They are created by…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: HO H. OH 2-H OH OH 20. To the left is the structure of ribose, with (most of) the carbons numbered.…
A: Ribose is a five-carbon monosaccharide that is a component of nucleotides, the building blocks of…
Q: How does the bicarbonate buffer system of the mammalian blood plasma function?
A: The bicarbonate buffer system is a mechanism by which the pH of the blood is maintained between 7.34…
Q: myristic acid (14:0) carbon dioxide and water a. how many moles of ATP produced from 1 round of the…
A: Human cellular membranes contain myristic acid, albeit at much lower concentrations. It is a…
Q: IDENTIFICATION: 1.Complex organic compound w/c has the ability of speeding chemical reactions w/out…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: Design an assay with purified phycocyanin to test protein stability using 500ml of 95% ethanol. Then…
A: Phycocyanin is a pigment that is found in cyanobacteria and algae. It’s a member of the…
Q: The tests we performed: Molisch’s test Benedict’s test Fehlings test Barfoed’s test Seliwanoff’s…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Acetone, CH3–(C=0) –CH3, and urea, NH2–(C=0)–NH2, have similar chemical structures. (a) Compare the…
A: Acetone, CH3–(C=0) –CH3 - it is an organic solvents which unfolds the protein by interfering the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- (E) Consider an amino acid that has one -amino group (pKa = 9.2), one -carboxyl group (pKa = 1.7) and one ionizable side chain (pKa = 6.2). At which pH range/s would this amino acid be effective as a buffer? If the amino acid shows a net charge of -1 at pH 11 and a net charge of +1 at pH 4, what pKa values would you use to calculate the isoelectric point? At what pH would the net charge be equal to zero?Given a stock protein solution with a concentration of 6 mg/ml, determine the protein concentration of a solution made by mixing 5 μl of the stock with 5 μl of a buffer.2 a. You are trying to purify protein C from a mixture of proteins noted in the above Table. If you had only one type of column to choose from, which one would allow you to purify protein C with the least number of contaminants? Size exclusion column Ion exchange column Affinity chromatography using glucose as the bait Affinity chromatography using NAD as the bait Please explain why you chose the column above based upon the properties of the column AND the proteins in the Table.
- Three proteins with an overall charges of 0, -5, and -8 are passed through an anion exchange column equilibrated in a buffer with low ionic strength and eluted with an increasing gradient of salt in a buffer. Which protein will elute last from the column? 1. Protein with no charge. 2. Protein with eight negative charges. 3. Protein with five negative charges. 4. Both charged proteins will elute at the same time. O 2 O 4 O 3 O 1Consider a crude extract with a mixture of the 5 proteins listed below. Protein A 4.5 pl 160 molecular weight, kDa Protein B 12.5 pl and 65 molecular weight Protein C 5.0 pl, 15 molecular weight Protein D 6.8 pl, 150 molecular weight Protein E 9.5 pl, 45 molecular weight You load this protein mixture onto an anion exchange column at pH 11. Next, you apply a "washing" step by passing through buffer at pH 11. Finally, for your elution step, you apply a pH gradient starting from pH 11 to pH 2.0 (A gradient buffer system allows you to gradually and continuously change the pH of your mobile phase starting from pH 11 up to pH 2). You load this same protein mixture onto a Size Exclusion column. Please indicate the order in which these proteins will elute for both. Group of answer choices Yes or No, please explain your answer. If your protein of interest is protein A, would using anion exchange column be completely successful at separating it from all the other proteins? Group of answer…4. The table below describes a procedure in preparing standard solutions of a protein sample with different concentrations. (A) Determine the concentrations of each tube if the starting concentration of the protein is 500 mg ml (B) Determine the equation of the line if the concentration (x-axis) was plotted vs the absorbance (y-axis). (C) What is the concentration, in mg ml of the diluted unknown protein sample if the absorbance at 595 nm is 0.333? Tube Volume of protein, Volume of water, Final concentration, Absorbance mL mL mg ml [at 595 nm) 1 0.00 5.00 0.113 2 0.70 4.30 0.184 3 1.40 3.80 0.251 14 2.10 2.90 0.329 2.80 2.20 0.385 3.50 1.50 0.454 7 4.20 0.80 0.503 5.00 0.00 0.577
- Discuss how buffers help prevent drastic swings in pH.You had a second solution with an unknown concentration of Protein X that had to be diluted 4x before you could measure the absorbance. The diluted solution had an absorbance of 0.76. What is the concentration of the diluted solution in ug/ml and what is the concentration of the original solution5 You need to separate the following three proteins, Protein A (MW 76 600 Da; pI 4.5); Protein B (MW 70 000 Da and pI 8.2) and Protein C (MW 42 000; pI 8.6). Describe what column/s you would use, the pH of the buffer/s you would use, which proteins are retained on the column and how you would elute the bound protein/s. How would you monitor where the protein peaks elute and whether the protein in each peak is pure of not?
- 6a. Using your 5 mg/mL stock solution, you wish to make 100µL of the correct concentration of protein to load. How do you make this working solution? (Yes- you would want this to be in 1x sample buffer, but that makes this question more complicated. So for this question just make the protein in water.) Volume of 10mg/ml Final Volume ! 1 100μL of protein 6b. This is a 1: A N Body* @ 2 W S dilution. #3 X E D $ 4 A C R F B I % 5 T V MacBook Pro U וכ H E U 8 N J ( 04. A solution containing egg albumin (pl-4.6), B-lactoglobulin (pl-5.2), and chymotrypsinogen (pl=9.5) was loaded onto a column of diethylaminoethyl cellulose (DEAE-cellulose) at pH 5.4.The column was then eluted with a pH 5.4 buffer, with an increasing salt concentration. Predict the elution pattern.What amino acids will be positive at a pH of 2? Use the pKa table