Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CCC to CCA in DNA, what dipeptide is formed? c. If a mutation converts CCC to CGC in DNA, what dipeptide is formed? d. If a mutation converts CCC to GCC in DNA, what dipeptide is formed?

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: 4A.According to Watson-crick base-pairing rule-  Double-stranded DNA is complementary in nature that…

Q: A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C]…

A: According to Chargaff's rule the percentage of Adenine [A] is equal to Thymine [T]. So if the given…

Q: In the: Exposure to a substance that mutates the Shine-Dalgarno sequence. Explain: (a) What is the…

A: (a) Shine-Dalgano sequences are ribosomal binding site in bacterial or archeal messenger RNA. So if…

Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: A small section of bacterial DNA antisense strand has the following nucleotide sequence: GCC CAC…

A: An Antisense DNA strand directed in 5’ to 3’ end is the non-coding DNA strand of a cell which acts…

Q: Two circular DNA molecules, which we can call molecule A andmolecule B, are topoisomers of each…

A: Supercoiling of deoxyribonucleic acid (DNA) is the under or overwinding of DNA strands. Supercoiling…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: HDAC's are important enzymes involved in the regulation of Gene expression. This is because a. They…

A: HAT stands for Histone acetylase. HDAC stands for Histone Deacetylase.

Q: If you had a protein that developed a mutation that changed its TEMPLATE strand from 5’GAT 3’ to…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: a) What dipeptide is produced from the following segment of DNA: AGAGAT? (b) What happens to the…

A: Gene expression is the process in which information stored in the DNA is converted into the…

Q: Using the DNA strand shown here as a template, what will be the sequence of the RNA transcript? 5'…

A: A template is the strand that attach to the complementary strand via DNA polymerase and RNA…

Q: Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…

A: DNA is a double helical structure containing complementary base pairs.  Complementary base pairs…

Q: What might be the result of a mutation of DNA in which a triplet code such as UAC now says UAA in…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: f a DNA-binding protein “reads” a short stretch of DNA and detects the following “second” genetic…

A: In DNA, there are four nitrogenous bases namely, Adenine (A), Guanine (G), Thymine (T) and Cytosine…

Q: Explain how the structure of DNA enables the molecule to be easily transcribed. Why is this…

A: DNA has a primary  structure of double stranded helix with the building blocks as nucleotides. The…

Q: σ factors bind to what types of sequences on DNA?    a. Shine-Delgarno sequences.   b. TATA box…

A: Sigma (σ) factor of RNA polymerase holozyme is a DNA binding promoter that determines transcription…

Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: What would happen to DNA repair in bacteria if MutH is mutated such that is cannot recognize the…

A: In prokaryotes , Mut H involved in mismatch repair syatem.  Mut S can recognise mismatched…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Where would you expect DNA-binding proteins to bind if they recognize a specific base sequence? What…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that transfers genetic information from one…

Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…

A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.

Q: Describe the d=features of the following DNA-binding domains and how they interact with DNA.…

A: DNA-binding domain abbreviated as DBD is a protein domain that is folded independently and contains…

Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…

A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…

Q: (i) (.. From the diagram to the right of the trp repressor in its approximate binding relationship…

A: Tryptophan (trp) repressor: It's a transcription factor that regulates amino acid metabolism. The…

Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…

A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…

Q: In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give…

A: 1 a) No, there wont be any problem in expressing the two genes. But in bacteria, most of the gene…

Q: ’. Envision that each is a section of a DNA molecule that has separated in preparation for…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Cytosine

A: Introduction :- A mutation occurs when a DNA gene is damaged or changed in such a way as to alter…

Q: (a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many…

A: The process of translation or protein synthesis occurs in the cytoplasm of a cell in both…

Q: a) Within Region 1, which strand will be the template for leading strand synthesis, the top or the…

A: Dna replication occur inside the nucleus and it require the enzyme and other replication factors and…

Q: Which of the following describes a Z-DNA helix? a. It is inhibited by methylation of bases b. It is…

A: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a double…

Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…

A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…

Q: A. In the product, the underlined regions are called what? B. What functional groups are present in…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…

Q: which of the following sequences would most likely be able to bind a cyclic amp dna binding protein?…

A: Introduction: Nucleotides are the nitrogenous base, a pentose sugar and phosphate group. Nucleotides…

Q: We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each…

A: As you have posted multi-part question.I am answering only first 3. For remaining answers post them…

Q: I only need letter D

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…

Q: Using the figure below identify: What is a function of introns and exons? What is a role of mobile…

A: DNA is packed up compactly in the nucleus of a cell in close association with histone proteins…

Q: Which of the following sequences would most likely be able to bind a Cyclic AMP DNA binding protein?…

A: Cyclic AMP or cAMP is one of the most important secondary messenger prevalent in biochemical signal…

Q: For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides…

A: Transcription is the DNA dependent RNA synthetic process. RNA polymerase help in the transcription.…

Q: The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1:…

A: DNA is a hereditary molecule found in cells that transmits genetic information from one generation…

Q: H H H.

A: The genetic material in all organisms is DNA where RNA is found in viruses as genetic material.…

Q: Explain why two metal ions play important role on the palm domain of DNA polymerase.

A: Please follow step 2 for detailed explanation.

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Blood is a body fluid that carries necessary nutrients and oxygen to the cells and transports…

Q: A DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine,…

A: Genome is not a static entity. It is dynamic in nature. It is subject to different types of…

Q: Why can’t a G bind to T?…

A: A, T, G, C, and U (in RNA) are nucleotide base pairs that form hydrogen bonds between them that…

Q: With respect to DNA binding motifs and their characteristics choose the correct answer O A. All DNA…

A: DNA-binding domains (DBD) are protein domains that can fold independently. They have at least one…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.