C. Two mutations are known in the population, one shaded in yellow and one in blue, shown on the TEMPLATE DNA sequence below. Ursula has a mutation in the yellow-shaded underlined nucleotide: instead of an A in this position, she has a T.5' AATCATAACTCATTG3'What type of mutation does Ursula have?Second positionFirst position (5000 0UUUUUC pheUUAUUGCOU leuCỰUCUCCUACOOCUGADOAUUAUC ilenovAUAAUG metGUUGUCGUAGUGvalUCUUCCUCA serUCAUCGCOUCCUcceCCCCCA proCCACCGACUwwwACCACAACGGCUGCCGCAGCGthralaUAUtyrUACUAA StopUAG StopCAUCAC hisCACCAAginCAGAAUAAC asnAACAAAlysAAGGAUGAC aspgluGAAGAGUGUUGC cysUGA StopUGG trpCGUMissenseSilentNonsenseFrameshiftCGCCGA argCGACGGAGUAGCAGAAGGGGUGGCGGAGGGInitiation TerminationserargglyDUAG DUMU DUAU DUAGThird position (3-end)

Name: C. Two mutations are known in the population, one shaded in yellow an
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: C. Two mutations are known in the population, one shaded in yellow and one in blue, shown on the TEMPLATE DNA sequence below. Ursula has a mutation in the yellow-shaded underlined nucleotide: instead of an A in this position, she has a T.5' AATCATAA

Introduction : Any alteration to DNA is referred to as a mutation. Any genetic and heritable…

Science

Biology

C. Two mutations are known in the population, one shaded in yellow and one in blue, shown on the TEMPLATE DNA sequence below. Ursula has a mutation in the yell shaded underlined nucleotide: instead of an A in this position, she has a T. 5' AATCATAACTCATTG 3' What type of mutation does Ursula have? Second position C UCU UCC UCA UCG ▬▬▬▬▬▬▬▬° UUU UUC phe UUA UUG CỰU ANH leu CUC CUA CUG AUU AUC ile AUA GUU GUC GUA GUG ACC ACA AUG met ACG val CCU CCC CCA Pro сса ACU ser thr UAU UAC tyr UAA Stop UAG Stop his CAU CAC CAA CAG gin AAU AGU AAC AGC ser AAA AAG asn Missense Silent Nonsense Frameshift lys GAU GAC p GAA glu GAG UGU UGC cys UGA Stop UGG trp CGU CGC CGA CGG GCU GCC ala GCA GCG Initiation Termination arg AGA arg AGG GGU GGO GGA D GGG gly DOMO DONO DOMO DOMO ст

C. Two mutations are known in the population, one shaded in yellow and one in blue, shown on the TEMPLATE DNA sequence below. Ursula has a mutation in the yell shaded underlined nucleotide: instead of an A in this position, she has a T. 5' AATCATAACTCATTG 3' What type of mutation does Ursula have? Second position C UCU UCC UCA UCG ▬▬▬▬▬▬▬▬° UUU UUC phe UUA UUG CỰU ANH leu CUC CUA CUG AUU AUC ile AUA GUU GUC GUA GUG ACC ACA AUG met ACG val CCU CCC CCA Pro сса ACU ser thr UAU UAC tyr UAA Stop UAG Stop his CAU CAC CAA CAG gin AAU AGU AAC AGC ser AAA AAG asn Missense Silent Nonsense Frameshift lys GAU GAC p GAA glu GAG UGU UGC cys UGA Stop UGG trp CGU CGC CGA CGG GCU GCC ala GCA GCG Initiation Termination arg AGA arg AGG GGU GGO GGA D GGG gly DOMO DONO DOMO DOMO ст

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
a. As a result of the structure of DNA and RNA, replication, transcription and translation are possible. What can nucleic acids do, as a result of their structure, that enables these processes to occur? The figure below shows a simplified schematic representation of a segment of DNA. The DNA is labelled with the numbers 1 – 14 for easy reference. -35 sequence Pribnow box 5' UTR 3' UTR DNA TTGACA TATAAT -35 -10 Gene a Gene B Gene y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 UTR = untranslated region b. At which position on the DNA (number 1 - 14) will transcription be initiated? c. At which position on the DNA (number 1 - 14) will the first signal for translation be found? d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to indicate the region. e. Between which two regions on the DNA will the first Shine-Dalgarno / Ribosome Binding Sequence be found? Use the numbers to indicate the region.
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility
8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?
7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCCGTTAC 7b. Where did the mutation take place?
6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC 6b. Where did the mutation take place?
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may choose than In event, explain choice(s). more one answer. any your I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C>A mutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning. C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation? In your own words, explain your reasoning.
Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key: