BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'- GTGATGTAG -5' The sequence shown on the gel is the sequence of the template strand of the reaction The sequence shown on the gel is complementary to the template strand of the reaction The template strand of the reaction is antiparallel to the sequence shown on the gel The largest fragment shown on the gel is closest to the top The largest fragment shown on the gel is closest to the bottom Each of the fragments shown on the gel have a primer incorporated at their 5' end Each of the fragments shown on the gel have a primer incorporated at their 3' end The number of nucleotides in the shortest band on the gel is 21 The number of nucleotides in the longest band on the gel is 21

BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'- GTGATGTAG -5' The sequence shown on the gel is the sequence of the template strand of the reaction The sequence shown on the gel is complementary to the template strand of the reaction The template strand of the reaction is antiparallel to the sequence shown on the gel The largest fragment shown on the gel is closest to the top The largest fragment shown on the gel is closest to the bottom Each of the fragments shown on the gel have a primer incorporated at their 5' end Each of the fragments shown on the gel have a primer incorporated at their 3' end The number of nucleotides in the shortest band on the gel is 21 The number of nucleotides in the longest band on the gel is 21

Name: BOTTOMThe sequence depicted on the gel is 5'-GTGATGTAG-3'The sequence
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: BOTTOMThe sequence depicted on the gel is 5'-GTGATGTAG-3'The sequence depicted on the gel is 3'- GTGATGTAG -5'The sequence shown on the gel is the sequence of the template strand of the reactionThe sequence shown on the gel is complementary to the t

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 15QP: Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw...

See similar textbooks

Similar questions

Draw the structure of the dipeptide Gly-His in its fully protonated form. Gly-His Select / Draw C H N Templates O More Erase + 2 Q
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
You have an aqueous solution containing: Alaine (a mono-amino, monocarboxylic acid) Fructose (a non-ionic monosaccharide) Glycogen (a non-ionic large polysaccharide) Ribose-5-phosphate (an anionic monosaccharide phosphate) t-RNA (a polyanionic nucleic acid, MW~ 30,000). Assuming you have a distinctive assay for each of these compounds, what procedures would you use to obtain gram quantities of each of these compounds free of each of the other compounds
Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
If the recognition sequence of the restriction enzyme HindiIl is AAGCTT, then how many covalent bonds will be broken by the enzyme in the following DNA molecule? 5'-T-C-A-A-G-C-T-T-C-G-A-A-G-C-T-T-G-A-3 3-A-G-T–T-C-G-A-A-G-C -T-T-C-G-A-A-C-T-5 А. 1 В. 2 С.3 D. 4
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)
Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the following sequence of a template. 3’ – GGGCTATACCTGACCCTC – 5’
5’ - A T G G C C C A A C T G A C C - 3’ a. How many nucleotides are listed here b. How many codons are listed here c. What are the three structural components of one nucleotide D.Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5’ and which end is 3 E.If the above sequence is the coding strand, write the RNA strand that will be transcribed