5. This is the same gene as #1, but with a mutation!! (insertion of CG at base pair 29) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? C. 5'- CAAATTAATOGECGGCATTTACGATGGTGCGGGATCATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACGCCCTAGTAATGTAACTGATTGC -5' -+- --+-- -+- -+-

4. This is the same gene as #1, but with a mutation!! (C/G-T/A at base pair 33) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? C. 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATTATTACATTGACTAACG -3' 5 1 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAATAATGTAACTGATTGC -5' C. 1 -+ --+-- --+-- 5. This is the same gene as #1, but with a mutation!! (insertion of CG at base pair 29) a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now What type of mutation is this? --+-- -+-- 51- CAAATTAATGGEGGO 5'- CAAATTAATGGCGGCATTTACGATGGTGCGGGATCATTACATTGACTAACG -3' 5 -+-- 1 -+- 3'- GTTTAATTACCGCCG 3'- GTTTAATTACCGCCGTAAATGCTACCACGCCCTAGTAATGTAACTGATTGC -5' -+-

3. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b. Transcribe Translate C. 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATCATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAGTAATGTAACTGATTGC -5′ -+- -+--- --+−−· ---+--

6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…