1:56 .ll0.02KB/S554.pdfCHEM 3141: BioChemistryQuiz no.4 -The double-stranded DNA sequence for a bacteria is shown below and it's coding for ahypothetical protein. The strand on top reads 5' to 3' left to right, while the strand on the bottomreads 5' to 3' right to left. The nucleotides are numbered 1 to 100. REMINDER: For thisproblem, transcription begins with and includes the red and underlined C/G (top strand/bottomstrand) base pair and RNA polymerase proceeds from left to right along the DNA.1.20405-СТСТСССТСТААТАТТСТGAGAТСТТАТАТСССССССТСААСАССАТСАА-3.------+----------+3'-САСAGGCAGATTATAACACTCТАСААТАТАGGGCGGCAGTTCTGGТАСТT-5*60801005'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3'-------+3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5'1. What are the nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA.2. What are the amino acids translated from the resulting mRNA?3. Do the underlined nucleotides TAA (indicated in blue) encode a stop codon for the protein?Briefly explain your answer. 1:55 .ll0.03KB/S562.pdfCHEM 2215: BioChemistryQuiz no.21. Identify the acid on the left and its conjugate base on the right in the following equations:(a) HOCI + H20 + H;O* + OCI(b) HONH2 + H20 + HONH*+ OH(c) NH," + H,0 + NH3 + H;0(d) 2HCO,2+ H,CO; + CO;(e) PO, + H,PO, + 2HPO,2. Calculate the pH of water at 25°C and 75°C. The values for pKw at these temperatures are13.99 and 12.70, respectively.3. What mass of sodium glycolate (NaC2H;O3) should be added to 400.0 mL of 1.00 M glycolicacid to produce a buffer solution with a pH of 4.00? K, = 1.47 x 104. Tris(hydroxymethyl)aminomethane [(HOCH2);CNH2 Tris, or THAM] is a weak basefrequently used to prepare buffers in biochemistry. Its K, is 1.2 x 10* and pK, is 5.92. Thecorresponding pK, is 8.08, which is near the pH of the physiological buffers, and so it exhibitsgood buffering capacity at physiological pH. What weight of THAM must be taken with 100 mLof 0.50 M HCI to prepare 1 L of a pH 7.40 buffer?5. Calculate the pH of a solution that is 0.200 M in NH; and 0.300 M in NH,CI. Calculate the pHchange that takes place when a 100-mL portion of (A) 0.0500 M NaOH and (B) 0.0500 M HCl isadded to 400 mL of the buffer solution. K, = 1.75 x 105

DNA stands for Deoxyribonucleic acid which is a molecule consisting of two polynucleotide chains. It…

5'-GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAA-3' --- 3'-CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTT-5' 60 80 100 5'-АCAGGATAAТССССТССТGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGСС-3. 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' 1. What are the nucleotides of the resulting MRNA? Indicate the 5' and 3' ends of the MRNA. 2. What are the amino acids translated from the resulting mRNA? 3. Do the underlined nucleotides TAA (indicated in blue) encode a stop codon for the protein? Briefly explain your answer.

5'-GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAA-3' --- 3'-CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTT-5' 60 80 100 5'-АCAGGATAAТССССТССТGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGСС-3. 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' 1. What are the nucleotides of the resulting MRNA? Indicate the 5' and 3' ends of the MRNA. 2. What are the amino acids translated from the resulting mRNA? 3. Do the underlined nucleotides TAA (indicated in blue) encode a stop codon for the protein? Briefly explain your answer.

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Similar questions

Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
AKS 5c: Which student correctly explained what is occurring in the images? AEGCEE ECCUAE FACGAAAGCAEA 3' Met Leu Ser Tyr Tyr Gle Ser le Met Leu Ser Tyr Tyr Glu Ser le The 4th student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being O lined up for semi conservative replication. The second arrow must demonstrate the process of transcription since the DNA is being read at the ribosomes and the monomers of protein are being connected. The 1st student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being lined up for semi conservative replication. The second arrow must demonstrate the process of translation since the RNA is being read at the ribosomes and the monomers of protein are being connected. The 2nd student explains the first arrow must demonstrate how the base pairing rule
AKS 5b: Which statement is correct regarding the semiconservative nature of DNA? * The semiconservative nature of DNA allows for genetic stability in somatic gene production MRNA operates as a template to allow DNA to replicate itself using ribosomes The structure of the phosphate group on the DNA molecule direct the correct nucleotides into place during replication Nucleotides in each original strand serve as a template for the new strand to be made AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * * AA AA AA AA АВ ВА AA BB AA AA АВ АС Figure A Figure B Figure C Figure D
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
20:201 Foundations Cell Molec 48. The first 17 amino acyl residues in human preproinsulin are H₂N-MALWMRLLPLLALLALW-COOH and the encoding nucleotide triplets ("codons") in DNA are 5'-ATG GCC CTG TGG ATG CGC CTC CTG CCC CTG CTG GCG CTG CTG GCC CTC TGG-3'. Are these molecules written according to their colinearity? A) No. Colinearity is written C-N and 3'-5' for proteins and nucleic acids, respectively. Yes. Colinearity is written N→C and 5'-3' for proteins and nucleic acids, respectively. No. Colinearity is written C-N and 5'-3' for proteins and nucleic acids, respectively. D) There is no such a thing as colinearity. red by ribozymas
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…
Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING: a.Complementary Strand: b. Direct Transcript: c. Transcript for Translation: d.Translated Amino Acid Sequence:
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer