5'-GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAA-3' --- 3'-CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTT-5' 60 80 100 5'-АCAGGATAAТССССТССТGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGСС-3. 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' 1. What are the nucleotides of the resulting MRNA? Indicate the 5' and 3' ends of the MRNA. 2. What are the amino acids translated from the resulting mRNA? 3. Do the underlined nucleotides TAA (indicated in blue) encode a stop codon for the protein? Briefly explain your answer.
5'-GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAA-3' --- 3'-CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTT-5' 60 80 100 5'-АCAGGATAAТССССТССТGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGСС-3. 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' 1. What are the nucleotides of the resulting MRNA? Indicate the 5' and 3' ends of the MRNA. 2. What are the amino acids translated from the resulting mRNA? 3. Do the underlined nucleotides TAA (indicated in blue) encode a stop codon for the protein? Briefly explain your answer.
Anatomy & Physiology
1st Edition
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Chapter3: The Cellular Level Of Organization
Section: Chapter Questions
Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...
Related questions
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution!
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College