4. The molecular structure of the last 12 amino acid residues (dodecapeptide) that comprise the C-terminal segment of semaglutide is shown below.NH₂H₂NNHHONHNHCH 3NHCH3CH 3NHNHΝΗCH3CH3 ONHH3CNHCH3a) Determine the sequence of the dodecapeptide in one-letter code:b) Convert your sequence in (a) into three-letter code:H₂N. NHNHNHNHH₂N NHNHNHImc) How many of the a-carbons in this peptide sequence are chiral?d) How many peptide bonds are in this peptide?e) Predict the overall charge of this peptide at physiological pH.f) A biochemist synthesized the C-terminal dodecapeptide version of semaglutide but found that therewere other contaminating peptides. Based on your answer in (4.e), which ion exchange chromatographytechnique would you use to effectively purify the dodecapeptide from the mixture? (encircle one)anion exchangecation exchangeg) Briefly explain your answer in (4.f).

A peptide is a short chain of amino acid residues linked together via a peptide bond. Amino acid…

Answered: 4. The molecular structure of the last…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()
6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group of serine, threonine, or tyrosine residues. The R-group for phosphoserine is shown at right. A) The image below is an Isoelectric focusing strip that shows the unphosphorylated protein-of-interest (in blue). To which side of the unphosphorylated protein would you expect to see the phosphorylated protein? (Draw an arrow to indicate direction). Briefly justify your answer. un-phosphorylatable: Low pH Justify: B) To study the effects of phosphorylation, researchers often mutate a Ser/Thr to appear as though it is always phosphorylated or never phosphorylated at a particular site. What amino acid substitution should you use to preserve similar dimensions as Ser (or Thr) but make the side chain appear to be: constitutively (always) phosphorylated: Justify: Ser or Thr → O O=P-O O I CH₂ Ser or Thr➜ Phosphoserine High pH
27. Draw palmitic acid, identify a, B and w carbons, write out its short hand notation 28. Examine the peptide sequence below and then answer the questions: H2N-Gly- Leu- Ala-Asp-Cys-Asn-Trp-lle-Ser-Phe-Lys-Cys-Arg-Pro-coOH a. Circle the asparagine residue b. A possible intramolecular disulfide bond can be formed within this peptide between which two residues? c. Circle one residue which has a positively charged side chain under pH 7.4 d. Circle one residue which has a negatively charged side chain under pH 7.4 e. Circle the residue which can be phosphorylated
5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG
1. Amino acid analysis of the peptide gave the following residues: Asp Leu Lys Met Phe Tyr. The following facts were observed: Trypsin treatment had no effect. The phenylthiohydantoin released by Edman degradation was C-C-CH2. Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The tetrapeptide contained Leu, Lys and Met is some order. Cyanogen bromide treatment afforded a dipeptide, a tetrapeptide and a free Lys. What is the amino acid sequence for this heptapeptide?
A heptapeptide was found to have an amino acid composition of Asp, Leu, Lys, 2 Met, Phe and Tyr. (a) Trypsin has no effect on the heptapeptide. (b) The phenyl thiohydantoin released by Edman degradation revealed phenylalanine in the N-terminus. (c) Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The amino acid composition of the tetrapeptide was Leu, Lys, and Met. (d) Cyanogen bromide treatment yielded a dipeptide, a tetrapeptide, and free Lys. What is the amino acid sequence of this heptapeptide? Answer Format: (Three letter abbreviation with dash ie., Ala-Gly-…) *
Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide. I don't understand how the order of amino acids in Step 2 was arranged. Please explain. Thank you.
Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide.
2. Amino acid analysis of the a heptapeptide gave the following residues: Asp Glu Leu Lys Met Tyr Trp NH4+ The following facts were observed: a) Trypsin treatment had no effect. b) The phenylthiohydantoin released by Edman degradation was -C-CH₂ What is the amino acid sequence for this heptapeptide? OH c) Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The tetrapeptide contained Glu, Leu, Lys and Met is some order. d) Cyanogen bromide treatment afforded a tetrapeptide that had a net positive charge at pH 7 and tripeptide that had a zero net charge at pH 7.
For each polypeptide derived in the following sequences: 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCC 3' 1. Draw the structure of each polypeptide. 2. Label the amide bonds. 3. Identify the N-terminal and C-terminal amino acids. 4. Write the name of each polypeptide.
1. Amino acid analysis of the peptide gave the following residues: Asp Met The following facts were observed: a) Trypsin treatment had no effect. b) The phenylthiohydantoin released by Edman degradation was Leu Lys Phe Tyr What is the amino acid sequence for this heptapeptide? H C-C-CH₂ H c) Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The tetrapeptide contained Leu, Lys and Met is some order. d) Cyanogen bromide treatment afforded a dipeptide, a tetrapeptide and a free Lys.
The bacterially produced antibiotic gramicidin A forms channels in cell membranes that allow the free diff usion of Na+ and K+ ions, thereby killing the cell. This peptide consists of a sequence of Dand L-amino acids. The sequence of a segment of fi ve amino acids in gramicidin A is R-Gly-L-Ala-D-Leu-L-Ala-D-Val-R′. Complete the Fischer projection below by adding the correct group to each vertical bond.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS