4. Discuss and detail reasons why eukaryotic organisms appear to have more DNA than is necessary to code for all the possible proteins they have in their cells. Correlate the functions of DNA as
Q: 3. Label each part of a microtome and its function. B. 9 10
A: Microtome It refers to a cutting tool. It is used to generate thin slices of a substance called…
Q: How does the protein encoded by the KanR gene inactivate kanamycin? O by rapidly pumping the…
A: Kanamycin inactivation :-
Q: Write down the reasons why there are more than one active/passive transport system in most bacteria…
A: Active transport is defined as the movement of molecules across the cell membrane by using cellular…
Q: Is chrysanthemum a perfect or imperfect flower?
A: The name (Chrysanthemum) is gotten from the Greek chryos meaning gold and the anthemon means flower.…
Q: What percent of the energy stored at one trophic level is stored at the next trophic level?
A: Trophic levels in a food chain may be defined as positions occupied by organisms in the food chain.…
Q: Hello! Discuss the evidence used to establish the causal association between virus infection and…
A: Cancer is the stage of uncontrolled cell division causing the formation of tumors.
Q: 4.What is the fate of the fertilized ovule of a flower? Read and analyze the question and choices…
A: Flower is most conspicuous , fascinating, fragranted part of plant and is major characteristic of…
Q: What is the site of gaseous exchange in an insect?
A: Introduction We will write about the site of gaseous exchange in an insect in bellow step.
Q: What is one way that plants can respond adaptively to cold temperatures
A: Plants respond to cold temperatures by activating metabolic pathways that prevent their cells from…
Q: Mapping is the bioinformatics term used to describe alignment of sequence reads to a reference…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: how would you convince a person about the validity of evolution in taxonomy?
A: Introduction Evolution is the biological change in the characteristics of a species over a span of…
Q: What is the correct order of appearance in the fossil record, starting with the earliest: flowering…
A: Fossils are the remains of living organisms that was found after the organism was buried properly.…
Q: What is the significance of step-wise release of energy in respiration?
A: Introduction In this question we will discuss about the significance of step-wise release of energy…
Q: Question 1. Why is DNA replication called semiconservative?
A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.
Q: Enumerate and briefly describe five developmental processes in the starfish that are similar to the…
A: Introduction The sea urchin and starfish have pinching organs between their spines and tube feet…
Q: Explain what is diversity and how is this important in an ecosystem.
A: Biodiversity is defined as variability among living organisms, diversity within species, ecosystems,…
Q: how does the sequence of the primary transcript resemble the sequence of the gene encoding it
A: The genes undergo transcription to form mRNA. The mRNA is then modified via post-transcriptional…
Q: 3. a. In the process of converting ADP to ATP, water is circle one: (REQUIRED / RELEASED) and…
A: Cellular respiration is a metabolic process which involves degradation of glucose and Liberation of…
Q: Problem 7: Consider three neuron nodes: S1, S2, and S3 with thresholds T1, T2, and T3 given as…
A: A potential energy surface (PES) describes the potential energy of a system, especially a collection…
Q: In the liver fluke, the cercaria infect ants after leaving a snail (instead of the typical…
A: Questions related to the invertebrates.
Q: The deep scattering layer is created by which of these: a) seasonal changes in the thermocline b)…
A: Phytoplanktons are marine algae that are able to synthesize their own food due to presence of…
Q: Many scientists think that _______________ was the first information molecule to evolve. (a) DNA (b)…
A: The Earth has formed 4.6 billion years ago from the sun as a result of the constant bombardment of…
Q: 1. How often should treatment with azathioprine be monitored with liver enzymes and a full blood…
A: Azathioprine
Q: Explain why the nucleotide sequence of the same gene that you inherited from your mother and father…
A: we inherit two copies of each chromosome—one copy from your mom and one copy from your dad. This…
Q: suggest a reason why it would be advantageous for eukaryotic cells to evolve elaborate internal…
A: Eukaryotes comprise several organelles that are membrane-bound. This helps the cells in…
Q: What percent of the energy stored at one trophic level is stored at the next trophic level?
A: As the pyramid of energy is always upright which shows that at 100% transfer of energy is not…
Q: One of the important skills that must be acquired by the teaching staff in the health field…
A: Introduction Health care or healthcare is the maintenance or improvement of health through the…
Q: Several set of terms are used to indicate the direction and position when describing the relative…
A: Anatomical position is the portrayal of any locale or part of the body in a particular position. In…
Q: 7. Which of the following base sequences are probably not recognition sites for cleavage by…
A: Restriction endonucleases are the molecular cutters which is used to split DNA in the center but…
Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…
A: A gene is a stretch of DNA that codes for a polypeptide chain and is transcribed into mRNA.
Q: . In a normal individual, heart rate can be determined by the in an ECG.
A: ECG stands for Electrocardiogram. It is a test which measures the electrical activity of heart.…
Q: If you have determined that VG = 357, VD = 52, VI = 24 and VE = 5 for the shatter trait, what is the…
A: Narrow-sense heritability is defined as the fraction of phenotypic variance that can be attributed…
Q: Inbreeding Coefficient. Records from two different animal herds are provided. Compute for the…
A: Inbreeding coefficient Inbreeding coefficient means the probability of two individuals having same…
Q: In your point of view as a senior high school stem student, How will you raise an awareness on the…
A: Hypertension : It is the increase of the arterial blood pressure of blood exerted on the wall of…
Q: Q4.8. Which statement below is TRUE about the voltage-gated Na* channels during the action…
A:
Q: "back of the brain" is the Notice the arbor vitae within it.
A:
Q: Question 8. What method can be used to compare the transcriptomes of individual single cells?
A: Methods used for comparing the single cells transcriptomes.
Q: Give the different classes of each phylum. Phylum Echinodermata,Phylum Arthropoda and Phylum…
A: Animal kingdom consists of multicellular, eukaryotic animals. These are animals are divided into…
Q: 1. Why is dexamethasone not routinely used instead of prednisolone, which is almost universally used…
A: Dexamethasone
Q: Phenotype Genotype Temperature-sensitive allele Barr Body Dimorphism Cytoplasmic segregation Sum…
A: Genetics is the investigation of genes and heredity-of how certain characteristics or attributes…
Q: Describe the basic principles of the theory of evolution by naturalselection.
A: Darwin's Theory of Evolution is called natural selection and it is based on some basic concepts that…
Q: 1. Pick the odd one out and mention the category of the other a. kylem, parenchyma, collenchyma,…
A: We’ll answer the first unsolved question since the exact one wasn’t specified. Please submit a new…
Q: UVTA encodes a DNA repair protein and is regulated by LexA. Which of the following could be…
A: The uvrA gene codes for the repair protein and is negatively regulated by the LevA gene. The LevA…
Q: How many copies of a protein need to be present in a cell in order for it to be visible as a band on…
A: * Given that you can load 100 µg of cell extract onto a gel and can detect 10 ng in a single band by…
Q: 1. Which of the following is the correct order for the steps in DNA extraction? I. Precipitation of…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we are…
Q: the heart during a single complete are True/False. The duration of systole exceeds that o
A: The cardiac cycle is defined as the period between the start of one heartbeat to the start of the…
Q: Can you think of one organism not mentioned in thischapter as a keystone species that you believe…
A: Species are described using the biological species concept. These species are the fundamental units…
Q: The “big portion of the brain” that the narrator highlights first is the
A: Answer :- As we know that big portion of the brain is called cerebrum. And , The cerebrum is the…
Q: My mother who is a type 2 diabetes mellitus patient is taking empagliflozin, a SGLT2 inhibitor, for…
A: SGLT2 which stands for Sodium-glucose co-transporter-2 (SGLT2). It is a anti hyperglycemic drug.
Q: How does the presence of introns aid exon shuffling?
A: Exon shuffling is a mechanism, where two or more exons from different genes brought together, or…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…2. Consider the following DNA molecule. Assume this is the DNA sequence of the entire chromosomes. Assume there are no introns. 3' AATTAGCAGATGCATGATGCAATTACTAGCATGTAAGTA 5' 5' TПААТСGTТСТАСGTACTАCGTTAATGATCGTACATTCAT 3' Based on your knowledge of open reading frames, list the amino acid sequences of the possible protein or proteins that could be produced from this DNA sequence. You may use any codon table of your liking to complete the work. a. b. Suppose there was a sister chromatid generated from the chromosome sequence shown above. What would be its DNA sequence (provide the sequence in the space below. Be sure to identify the 5' and 3'ends)?1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence
- To test whether you understand the processes involved in the Central Dogma of Molecular Genetics, complete what is being asked, and finally with the Genetic Code table, determine what specific amino acids will be finally formed. Given DNA strand 3’ T A C T A G C C T A C T G C G 5’The partner strand of the given ________________The mRNA strand formed _____________The tRNA _____________The amino acids formed are ____________Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) TAAGCTAG3' DNA 5'GAGATCGATGTCCATCGATCGATCGAATTCGGAGCCAATT DNA 3'CT CTAGCTACAGGTAGCTAGCTAGCTTAAGCCTCGG TTAAATTCGATC 5' mRNA 5' Protein
- 3. After analyzing a DNA sequence for gene properties, the following sequences were reported at the positions provided at the table. Sequence Position (BP) TTGACA 18 TATAAT 42 AGGAGGT 75 ATG 86 UGA 187 TTTTTT 206 i. Identify what regions these positions represent. Provide justification for the identification. 2 ii. Draw an approximate diagram of the gene showing the regions. It is not necessary to draw it up to scale. 1 iii. What kind of organism does the Gene come from? Does the organism have a nucleus? Make an educated guess. 1 iv .Which of these positions would have been present if the organism was of the other type? Identify. 1Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…Name 3 structural features of the DNA and how they help the DNA perform its functions
- Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the segment of DNA: How many open reading frames (ORF) are in this sequence? How many amino acids are encoded in all open reading frames in this segment/sequence? Which strand is the template strand for the longest open reading frame?Mention and explain 4 characteristics of the Structure of DNA.1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?