3. The DNA sequence of a gene coding for a short polypeptide is TACGCTAGGCGATIGACT. Whatwould be the base sequence of the mRNA transcribed from this gene? Using the genetic code tableprovided, give the amino acid sequence of the polypeptide translated from this mRNA. (Hint: transcribethe DNA into RNA then translate the RNA into an amino acid!)First letterU$4CUUUUUUC JUUAUUGJCUUCUCCUACUGGPheLeuLeuAUUAUC lleAAUAAUG MetGUUGUCGUAGUGUCUUCCUCAUCGValSecond letterCCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCG5Bde LO%SerProThrTAlaACAC HisCAACAG} GinUA COCO TyrUAA Stop UGA Stop AUAG Stop UGG Trp GAAU{U} AsnAACAAAGAUTGACJGAATGAGJIAspGluGUGU CysUGC.6CGUCGCCGACGGAAG LYS AGA ArgAGGJAGUAGC.GGUGGCGGAGGGICArgSerGlyUYSYSCUGYSCсSCAOUGMCAOThird letter=>&7U8BEEEEEEE9

Transcription is a process of formation of mRNA from DNA, whereas tranlation is a formation of…

3. The DNA sequence of a gene coding for a short polypeptide is TACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? Using the genetic code table provided, give the amino acid sequence of the polypeptide translated from this mRNA. (Hint: transcribe the DNA into RNA then translate the RNA into an amino acid!) First letter U U UUU UUC J UCU UCC UCA UUGLeu UCG CUU CUC A CUA CUG G Phe Leu AUU AUC AUA lle AUG Met GUUT GUC GUA GUG Second letter Val C CCU CCC CCA CCG ACU ACC ACA ACG Ser GCU GCC GCA GCG Pro Thr A UAUT UACJ Ala CAU His CACJ Gin CAAT CAGJ Tyr UGCys UAA Stop UGA Stop A UAG Stop UGG Trp AAU AAC FAS Asn AAA AAG Lys GAU ASP GACJ Glu G GAAT GAGJ CGU CGC CGA CGG Arg AGU Ser AGC AGA Arg AGGJ GGUT GGC GGA GGG U DCAG UUA DUAG DCAG Gly Third letter

3. The DNA sequence of a gene coding for a short polypeptide is TACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? Using the genetic code table provided, give the amino acid sequence of the polypeptide translated from this mRNA. (Hint: transcribe the DNA into RNA then translate the RNA into an amino acid!) First letter U U UUU UUC J UCU UCC UCA UUGLeu UCG CUU CUC A CUA CUG G Phe Leu AUU AUC AUA lle AUG Met GUUT GUC GUA GUG Second letter Val C CCU CCC CCA CCG ACU ACC ACA ACG Ser GCU GCC GCA GCG Pro Thr A UAUT UACJ Ala CAU His CACJ Gin CAAT CAGJ Tyr UGCys UAA Stop UGA Stop A UAG Stop UGG Trp AAU AAC FAS Asn AAA AAG Lys GAU ASP GACJ Glu G GAAT GAGJ CGU CGC CGA CGG Arg AGU Ser AGC AGA Arg AGGJ GGUT GGC GGA GGG U DCAG UUA DUAG DCAG Gly Third letter

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU 3'
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
30. Below is a pre-mRNA sequence that contains 2 exons and an intronic region. Based on your knowledge of the spicing reaction, predict the ligated exon sequence. [ | (hint: there is a consensus sequence for this "cut n paste' rxn.] 5'-ACGACAGGAUGAAGGUAAAUCGGGUAGGGGCGGCUGACUCUCUUUUUCCCUCAGGUCGUAA-3'
6. How many amino acids will the mRNA sequence "AUG GÁC CUG UCG UGA" produce? (LS1-1) * Second mRNA base G UUU Phe UUC UCU UAU UGU Tyr UAC Cys UCC Ser UCA UGC C Phe Gly (G) Leu UAA Stop UGA Stop A Glu (F) (L) UUA Leu UUG Ser Asp (E) (D) (S) Tyr (Y) UCG UAG Stop UGG Trp GUC Ala CUU (A) A CCU CAU CGU His CUC Leu CUA CC Pro ССА CAC CGC Arg CGA Cys (C) Val CAA Gln CAG G U (V) G Trp (W) CUG CCG CGG Arg (R) G U A C A C Leu AUU ACU AAU Asn AGU Ser AGC (L) Ser (S) C AUC Ile ACC AAC Thr Lys (K) UG A AUA Pro AGA Arg AGG ACA AAA Lys AAG Asn (N) (P) AUG Met or start ACG His Thr (H) (T) Gln GUU GCU GAU Asp GAÇ GGU (Q) lle Arg (R) (1) GUC Val GUA GCC Ala GCA GGC Gly GGA GAA Glu OGAG GUG GCG GGG O 1 3 4 First mRNA base (5' end of codon) - U A GUca Gbc AG Third mRNA base (3' end of codon)
2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.