3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut DNA, how many DNA fragments will result? Circle the fragments. Uncut DNA 1: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTTAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Number of fragments: Uncut DNA 2: Number of fragments: TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Uncut DNA 3: Length of fragments: Number of fragments: Length of fragments: basepairs (ignore ends with unpaired bases) TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGCATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACGTAAGTTTTTT Length of fragments: basepairs (ignore ends with unpaired bases) basepairs (ignore ends with unpaired bases)

Q: Choose the incorrect statement for vernalisation D O Qualitatively and quantitatively dependent on…

A: Russian scientist Lysenko discovered in 1928 that plants or moist seeds can be treated at low…

Q: What safety considerations must be taken before CRISPR-Cas isused to edit human embryos to cure…

A: The knowledge of fundamental gene activities and the creation of human disease models in animal…

Q: Define the Encyclopedia of DNA Elements(ENCODE) Project ?

A: The ENCODE (Encyclopedia of DNA Elements) Consortium is an international collaboration of research…

Q: Define about Human Genome Project (HGP). Explain why it is used ?

A: Introduction: The term "genome" refers to the entire set of genes on a haploid set of chromosomes.

Q: Use the values of the oxygen partial pressure on both sides of the resistance membrane to find the…

A: Diffusion capacity can be determined as the rate of movement of gases across the membrane that is…

Q: Which of the following does not participate in the Calvin cycle?

A: Photosynthesis is the process of the formation of glucose from carbon dioxide and water in the…

Q: Below are 9 possible primer pairs. ● Determine which primer pair is the best choice. ● Explain why…

A: Primers are used in the PCR or polymerase chain reaction. These primers anneal at a particular…

Q: ose d CAP lac I repressor allolactose CAMP C RNA Pol promoter operator +1 lac Z lac Y lac A DNA

A: E.coli's Lac operon contains the genes required for the lactose metabolism. Genes involved in the…

Q: Question 34 The biosynthesis of amino acids can only be carried out by O nitrogen-fixing bacteria

A: Introduction The amino acids building material of proteins. Proteins and amino acids are the…

Q: Describe the general functions of each organ system

A: A set of organs which cooperate to carry out one or more activities is known as an organ system in…

Q: Why sequences are important for chromosome structure ?

A: Genes makes up the chromosomes. The molecules needed for life are encoded by genes. A chromosome's…

Q: Compare endocrine and exocrine glands

A: Several glands in the human body secrete numerous substances, including perspiration, saliva, oil,…

Q: What are differences between summer and winter melons? (select all that apply) summer are…

A: Melons are categorised into two groups based on the season: summer melons and late or winter melons.…

Q: plain with an example- 'enzymes are very powerful cataly

A: A catalyst is a chemical that speeds up a reaction without becoming consumed by it, and enzymes are…

Q: How are the characteristics of life dependent onmetabolism?

A: Your body turns the food and liquid you consume into energy through a process known as metabolism.…

Q: Why should medical students observe multiple cadavers and not be satisfied to dissect only one?

A: An unusually deceased human body is referred to as a "cadaver." The terms "cadaver" and "corpse" are…

Q: What do each of the 8 steps of the citric acid cycle have on common?

A: The citric acid cycle (CAC) is a series of chemical reactions that release stored energy through the…

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Describe the factors that affects the pro-environmental behavior.

A:

Q: 3. Relative to the values given below, predict whether the concentrations of O2, CO2, and pH would…

A: Introduction :  Photosynthesis is the process of preparing food in the presence of sunlight and…

Q: Explain about personal genomics approach ?

A: Finding the nucleic acid sequences, or the arrangement of nucleotides in DNA, is the procedure of…

Q: re is the statement below,  If a patient sample gets a negative result on the urea broth test, then…

A: A laboratory test called the urea broth test is done to determine whether or not a patient has a UTI…

Q: What is procedure in practice of kin selection work?

A:

Q: THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes…

A: Note: You have asked multiple sub part questions but as per our instructions we are instructed to…

Q: Compare and contrast sexual reproduction vs. asexual reproduction.

A: Answer :-

Q: Which are Muscle Cells?

A: All cells in the body have a basic structure called a cell membrane. The various characteristics of…

Q: Read the case description carefully and then respond to the individual questions. Primary…

A: 1. The most likely diagnosis of the patient as per the physical examination and diagnostic tests…

Q: What component have evolved first, the electron transport chain in chloroplasts or in mitochondria?

A: Following I will be discussing what evolved first the electron transport chain in mitochondria or…

Q: What is cell membrane

A: Cell membrane is the thin membrane that surroundsCell contains proteins, nucleic acids,…

Q: Which one of these is not a true fruit?

A: True fruits develops only from the ovary.. eg. mango, tomato  True fruits consists of seed inside…

Q: a Synergistic mechanism has been used as the hurdle technology in the food preservation process. (a)…

A: Following i will be answering questions regarding hurdle technology in food preservation:- Hurdle…

Q: HO What type of nucleotide is shown? a. RNA and a Purine Ob. DNA and a Purine Oc. RNA and a…

A: Introduction: A nucleotide is  made up of three components,a nitrogenous base, phosphate group,…

Q: mponent have evolved first, the electron transport chain in chloroplasts or in mitoc

A: Because chloroplasts contain the green pigment chlorophyll, they are not recognised in plant…

Q: How can gene knockouts, transgenic animals, and geneeditingtechniques be used to explore gene…

A: Gene is the functional unit of hereditary. Each cell has a nucleus, in which there is nucleic acid…

Q: Which hormone is produce in the male reproductive system?

A: The male gametes in humans are known as sperms, and the process through which they develop is known…

Q: Which bacteria are usually to blame for acute endocarditis? Strep pyogenes Staph aureus Staph…

A: INTRODUCTION Endocarditis Infection of heart lining including the heart valves.

Q: Why nonhomologous end-joining (NHEJ) is helpful ?

A: Non-homologous end joining (NHEJ)  Is a repair process for double-strand DNA breaks. In contrast to…

Q: me following illustration shows a sequence of reactions at equilibrium: the reaction A => B would be…

A: Chemical equilibrium exists in reversible reactions only. At equilibrium, the rate of the forward…

Q: Jan and Michael are both carriers for the cystic fibrosis allele. If Jan and Michael have five…

A: Introduction Cystic fibrosis (CF) is a genetic disorder, which means it is transferred from…

Q: Historically, agriculture is one of the most environmentally destructive human activities but why…

A: At the nexus of environmental science, ecosystem, evolution, and global change lies environmental…

Q: List the advantages and disadvantages of using plasmids as cloningvectors. What advantages do BACs…

A: YACs (years artificial chromosomes) are frequently used to replicate DNA in yeast and include…

Q: What is stratified epithelium?

A: Epithelial cells  Cells that line your body's surfaces. They can be observed on ones skin, blood…

Q: Think about what it would be like to go back in time and be one of the scientists working on the…

A: Cell theory:  The cell theory was formulated by Theodor Schwann, Matthias Jakob Schleiden, and…

Q: is Photosynthesis is a only process in which oxygen is created within the plants? Can fermentation…

A: Introduction Plants and animals involve various pathways for obtaining energy. An example of such…

Q: Entamoeba histolytica

A:

Q: Fill – up the taxonomic account of each echinoderm species representatives and label the visible…

A: Introduction :  Taxonomy is the way to classify organisms on the basis of similarity and…

Q: Finger mid-digital hair (M) is dominant over the recessive trait of no mid-digital hair (m).…

A: Given, 1. Finger mid-digital hair (M) is dominant No mid-digital hair (m) is recessive 2. Freckles…

Q: Considering the genotypes for the ABO locus and the H-locus of the patient below. what blood type do…

A: There are four blood groups A, B, AB or O. These blood groups are named after the antigens they…

Q: Please explain pros and cons to ketosis

A: Introduction Ketosis can be defined as the process that occurs when our body does not have enough…

Q: (b) What volume of new cytoplasm will the new cell have to synthesize as it matures? (c) Calculate…

A: Yeasts are unicellular eukaryotic organisms that are widely used in the baking and wine industries…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.