2. Scientists now routinely use CRISPR/Cas9 to makedefined deletions of a gene that can remove several kbof DNA from the genome. This method is possibleeven in cells defective in homologous recombination,as long as the cells can still perform nonhomologousend-joining (NHEJ). a. How could researchers make such deletions?
Q: reproductive cloning
A: Apart from the natural reproduction of various organisms in our ecosystem, the advent of technology…
Q: 1. Why do you think SNPS are more commonly found in intergenic regions ? a.Because intergenic…
A: Single nucleotide polymorphism (SNP) is the change in the single nucleotide through addition or…
Q: 1) Which of the following are referred to as retrotransposons? a) VNTRS b) SINES c) LINES d) STRS 2)…
A: As per our honor code, we are authorized to answer only one question at a moment. So, we are…
Q: How are Recombinant DNA formed?What is the difference between genetic modification and selective…
A: Recombinant DNA technology is a new approach to modify the genome of a host organism by joining two…
Q: 2. Discuss the use of transposons as mutagens in bacteria.
A: Transposable elements are segments of DNA that can move around the genome. Classification of…
Q: 4. Some transposases use extensive DNA replication to leave one copy of the element behind in a…
A: Trnasposases are the enzymes that identify the inverse terminal repeat sequences within the DNA and…
Q: 5. If you are able to successfully incorporate foreign DNA to your host organism, what are your…
A: A foreign DNA is a DNA that is transferred into a species from other source and not that of parent.
Q: The first genetic test developed for this disease took advantage of a large family of over 2,000…
A: Huntington’s disease is a neurodegenerative disease. The symptoms of the disease start mildly such…
Q: 3. Why will we put your cheek cells in the InstaGene solution? In other words, why do we want to…
A: DNA isolation is one of the crucial steps in molecular biology and should be performed with care and…
Q: 3. Which of the following statement is FALSE about CRISPR? A. The size of CRISPR locus is usually…
A: Introduction CRISPR stands for clustered regularly interspaced short palindromic repeats, and it is…
Q: Methods of gene therapy
A: Note: Since you have posted multiple questions so we will be solving the first question for you. As…
Q: 4. Give the importance of Genomics especially in human. What are the different techniques in…
A: A genome is an organism's whole collection of DNA. The genomic DNA sequence is held within an…
Q: 4. A woman with skin cancer gets a biopsy of one of her tumors taken, and a sample of her blood. DNA…
A: It is given that The sequence of blood is 5' ATGCAAGTTCTAThe sequence of the tumor is 5' ATGCAAGTCTA…
Q: 3. We could use the CRISPR/Cas9 system to disrupt any gene, but this lab focuses on the lacz gene…
A: The CRISPR is a type of short palindromic sequence of DNA found in prokaryotic organisms. These are…
Q: 7. Explain the principle of quality determination of DNA.
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…
Q: 2. What is not true about Human Genome project? Determination of the gene location on the…
A: The Human Genome Project (HGP) was one of the incredible accomplishments of investigation ever.…
Q: 5.If the following two primers 3'AAGS' S'CCG3' were used to facilitate the polymerase chain reaction…
A: Deoxyribonucleic acid (DNA) refers to the polymer that is made of nucleotides. A nucleotide…
Q: 10. The three components of a plasmid which are crucial for gene cloning purpose are: 1) 2) 3)
A: Plasmids are a circular, double-stranded DNA of the bacteria and are able to self replicates hence…
Q: 17. A chromosome is found to be shorter than its homologous match. Which type of mutation would this…
A: Mutation can be described as a condition in genetics during which alternation occurs in an…
Q: 4. Consider that you identified an enzyme in a fungus which can digest plastic. You want to isolate…
A: In genetics, the set of procedures used to do genetic modification in an organism through the…
Q: 7. Fill in the blank. In the picture below, the oldest spacer that has been incorporated in the…
A: CRISPR is a group of DNA sequences that are found in the genomes of prokaryotic organisms like…
Q: )A scientist compares the sequence of a disease gene and a healthy gene and finds that these two…
A: The gene is the unit of heredity that is carried out from the parents to the offspring. This…
Q: 2. In the space below, the two parallel lines indicate a section of double-stranded DNA that is…
A: 5' - 3' direction alludes to the direction of nucleotides of a solitary strand of Deoxyribose…
Q: 6. Why do you think the Ames test is preferable to the use of animal models to screen chemical…
A: Ames test is used to find whether a given chemical causes mutation in the DNA in the animal models.…
Q: 4. The bars in the following sequence indicate the breakpoints of a deletion.…
A: The given sequence has bars indicating the breakpoint of a deletion means we are going to delete the…
Q: 8. For each of the following DNA template strands a. 3' TACGGC 5' b. 3' CCATTA 5' Determine: a. the…
A: The heterogenous nuclear ribonucleoprotein (hnRNP) is the initial step of synthesizing mRNA during…
Q: 1. What is the role of salt and dishwashing liquid in the extraction/isolation of DNA from yeast and…
A: "DNA extraction or DNA isolation" is a procedure or a method wherein DNA is purified by physical…
Q: 2. Give two different reasons for the much higher ratioof total DNA to protein-encoding DNA in the…
A: DNA is a polymer of nucleotides arranged in unique sequence in different organisms. It forms the…
Q: . An alternative form of a gene is called an
A:
Q: 9. differentiate between linkage and recombination
A: Introduction:- Linkage refers to the close proximity of genes or other DNA sequences on the same…
Q: 8. Using recombinant DNA techniques (which willbe described in Chapter 9), it is possible to take…
A: Recombinant DNA technology is the process in which the recombination of genetic material takes place…
Q: 1) Recombinant DNA technology and selective breeding are 2 techniques that seek to produce desirable…
A: WHAT IS RECOMBINANT DNA TECHNOLOGY AND SELECTIVE BREEDING ? - Recombinant DNA technology simply…
Q: What are the different elements you would need if you wanted to perform CRISPR to edit a gene?
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: Why is the TP53 called the guardian of the genome?
A: Genome The genome of an organism consist of whole genetic material. The both part of gene coding…
Q: 4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide…
A: Base substitution is the simplest type of gene mutation that involves the swapping of one nucleotide…
Q: 3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they…
A: A molecule that consists of Nitrogen and possess the chemical property of a base, is known as a…
Q: 1. Below is a gene on DNA in a prokaryotic cell. Draw the mRNA molecule that would be made from this…
A: It can exist in various forms like primary, secondary and tertiary based on its level of…
Q: 7. Why recombinant DNA is very useful in improving our health conditions? A. Human insulin can be…
A: Of the many advancements in biotechnology, invention of rDNA technology is most significant because…
Q: 1. In adults, these DNA regions would contain the genes for hemoglobin. a. euchromatin b.…
A: Chromatin can be defined as a complex threadlike structure made up of DNA and proteins found in…
Q: 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting…
A: TAS2R38 is a taste receptor gene present in the 7th chromosome of the genome. The length of a gene…
Q: 1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt…
A: A-DNA is one of the possible double helical structures which DNA can adopt. A-DNA is thought to be…
Q: 2. In your own words, define a gene.
A: A protein is a biomolecule that is made up of amino acids. They carry out many cellular processes as…
Q: 4. You can carry out matings between an Hfr and F−strain by mixing the two cell types in a small…
A: Bacterial conjugation is a process through which the DNA is transferred from the living cell into…
Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…
A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…
Q: What is meant by ‘annotating’ the genome? How is this done? Which process occurs first? How does…
A: Asked : Genome annotation process and difference from assembly
Q: 2. If a selection assay be made to identify cells that have incorporated the recombinant DNA, what…
A:
Q: 1. How does site specific recombination differ from homologous recombination? a. It requires a…
A: How does site specific recombination differ from homologous recombination Answer : a. It requires a…
2. Scientists now routinely use CRISPR/Cas9 to make
defined deletions of a gene that can remove several kb
of DNA from the genome. This method is possible
even in cells defective in homologous recombination,
as long as the cells can still perform nonhomologous
end-joining (NHEJ).
a. How could researchers make such deletions?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 4. You can carry out matings between an Hfr and F−strain by mixing the two cell types in a small patch ona plate and then replica plating to selective medium.This methodology was used to screen hundreds of different cells for a recombination-deficient recA− mutant. Why is this an assay for RecA function? Wouldyou be screening for a recA− mutation in the F− or Hfrstrain using this protocol? Explain.10. V(D)J recombination contributes to the diversity of immunoglobulins, and occurs by:A. Random single-strand nicks in the DNAB. Programmed double-strand breaks in the DNAC. Site-specific recombinationD. Homologous recombinationE. Retrotransposition 11. Zsuzanna Izsvak and coworkers set out to make a functional copy of a nonfunctional transposase in a fish that is estimated to have been nonfunctional for over 14 million years. The functional transposase became known as ____________________.A. Sleeping BeautyB. RumpelstiltskinC. PandoraD. Rip van WinkleE. None of the above 12. Which of the following Tn3 proteins catalyzes recombination to separate the donor and acceptor DNA molecules?A. transposaseB. DNA polymeraseC. RecAD. ResolvaseE. β-lactamase4. In two isolates (one is resistant to ampicillin and theother is sensitive to ampicillin) of a new bacterium,you found that genes encoding ampicillin resistanceare being transferred into the sensitive strain.a. How would you know that gene transfer is takingplace?b. To determine if the gene transfer is transformationor transduction, you treat the mixed culture of cellswith DNase. Why would this treatment distinguishbetween these two modes of gene transfer? Describethe results predicted if the gene transfer is transformation versus transduction.c. To determine if the gene transfer involves transformation, conjugation, or transduction, you separatethe ampicillin-resistant and ampicillin-sensitivestrains by a membrane with pores that are smallerthan the size of a bacterium, but larger than thesizes of bacteriophage or DNA fragments. If genetransfer is still observed, what mechanisms arepossibly involved and which are excluded?
- Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.1. Methods of gene therapy 2. Explain Small RNAs and long non coding RNA. 3.what is name of the technique that would help a person who inherited LFS to have a child without the defective allele? 4 .Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.) 5. If Dr. Aikenhed wanted to see if there was mutation within the protein-coding sequence of the gene implicated in this disorder (as opposed to mutations afecting regulatory elements), what technique involving dideoxynucleotides could be used? Briefy describe this technique.5. Currently you are studying threonine synthesis in E. coli. To find genes whose protein products are important for threonine synthesis, you perform a mutagenesis to find mutants that require a source of threonine to grow. mtl mt2 mt3 nt4 mt5 mt6 mt7 mt8 mt9 wt You find a total of nine mutants, all of which have recessive phenotypes. You perform complementation tests with all of your mutants. Below are the results for your complementation tests. A (+) means growth and a (- means no growth: mtl mt2 mt3 mt4 mt5 mt6 mt7 mt8 mt9 Wt a. How many complementation groups did you identify? For each complementation group, indicate which mutants belong to that complementation group. ++ I++++ + + + + 主+
- 6) If you had the ability to do gene editing with ONE gene for the betterment of human kind, which one would you choose, and why? Assume you could either change an abnormal allele associated with a disease, such as the cystin gene associated with Cystic Fibrosis to its normal wild type, or add a pre-existing human allele to a genome15. The CRISPR/Cas9 system provides a form of adaptive immunity in bacteria. We discussed in class that it can be used in human cells to: A: Protect cells from infection with viruses B: Kill cells that carry a specific deletion C: Give cells a memory of the viruses that have infected them D: Greatly enhance the frequency of homologous recombination at a chosen I locus E: Kill cells that have not undergone the desired genome edit4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence
- 2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 3'тTGCATССGAAАCGTACGATCGATCGGCCGACTТАТТАСGАТСGGACTAфTGCGTCсTAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'... (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i).2. Agarose gel electrophoresis of PCR products from samples taken from a healthy, a carrier, and an affected individual revealed DNA bands of different sizes. Please indicate what sample correspondingly belongs to healthy, carrier, and affected individuals, if you know that a shorter abnormal DNA fragment is obtained as a consequence of nonsense mutation. DNA marker 1 1000 bp- 750 bp Sumem 400 bp- CHOGA8. Using recombinant DNA techniques (which willbe described in Chapter 9), it is possible to take theDNA of a gene from any source and place it on achromosome in the nucleus of a yeast cell. Whenyou take the DNA for a human gene and put it into ayeast cell chromosome, the altered yeast cell canmake the human protein. But when you remove theDNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome inthe nucleus, the yeast cell cannot synthesize the correctprotein, even though the gene comes from the sameorganism. Explain. What would you need to do to ensurethat such a yeast cell could make the correct protein?