2. Scientists now routinely use CRISPR/Cas9 to makedefined deletions of a gene that can remove several kbof DNA from the genome. This method is possibleeven in cells defective in homologous recombination,as long as the cells can still perform nonhomologousend-joining (NHEJ). a. How could researchers make such deletions?

2. Scientists now routinely use CRISPR/Cas9 to makedefined deletions of a gene that can remove several kbof DNA from the genome. This method is possibleeven in cells defective in homologous recombination,as long as the cells can still perform nonhomologousend-joining (NHEJ). a. How could researchers make such deletions?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 8TYK

See similar textbooks

Similar questions

4. You can carry out matings between an Hfr and F−strain by mixing the two cell types in a small patch ona plate and then replica plating to selective medium.This methodology was used to screen hundreds of different cells for a recombination-deficient recA− mutant. Why is this an assay for RecA function? Wouldyou be screening for a recA− mutation in the F− or Hfrstrain using this protocol? Explain.
10. V(D)J recombination contributes to the diversity of immunoglobulins, and occurs by:A. Random single-strand nicks in the DNAB. Programmed double-strand breaks in the DNAC. Site-specific recombinationD. Homologous recombinationE. Retrotransposition 11. Zsuzanna Izsvak and coworkers set out to make a functional copy of a nonfunctional transposase in a fish that is estimated to have been nonfunctional for over 14 million years. The functional transposase became known as ____________________.A. Sleeping BeautyB. RumpelstiltskinC. PandoraD. Rip van WinkleE. None of the above 12. Which of the following Tn3 proteins catalyzes recombination to separate the donor and acceptor DNA molecules?A. transposaseB. DNA polymeraseC. RecAD. ResolvaseE. β-lactamase
4. In two isolates (one is resistant to ampicillin and theother is sensitive to ampicillin) of a new bacterium,you found that genes encoding ampicillin resistanceare being transferred into the sensitive strain.a. How would you know that gene transfer is takingplace?b. To determine if the gene transfer is transformationor transduction, you treat the mixed culture of cellswith DNase. Why would this treatment distinguishbetween these two modes of gene transfer? Describethe results predicted if the gene transfer is transformation versus transduction.c. To determine if the gene transfer involves transformation, conjugation, or transduction, you separatethe ampicillin-resistant and ampicillin-sensitivestrains by a membrane with pores that are smallerthan the size of a bacterium, but larger than thesizes of bacteriophage or DNA fragments. If genetransfer is still observed, what mechanisms arepossibly involved and which are excluded?
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
1. Methods of gene therapy 2. Explain Small RNAs and long non coding RNA. 3.what is name of the technique that would help a person who inherited LFS to have a child without the defective allele? 4 .Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.) 5. If Dr. Aikenhed wanted to see if there was mutation within the protein-coding sequence of the gene implicated in this disorder (as opposed to mutations afecting regulatory elements), what technique involving dideoxynucleotides could be used? Briefy describe this technique.
5. Currently you are studying threonine synthesis in E. coli. To find genes whose protein products are important for threonine synthesis, you perform a mutagenesis to find mutants that require a source of threonine to grow. mtl mt2 mt3 nt4 mt5 mt6 mt7 mt8 mt9 wt You find a total of nine mutants, all of which have recessive phenotypes. You perform complementation tests with all of your mutants. Below are the results for your complementation tests. A (+) means growth and a (- means no growth: mtl mt2 mt3 mt4 mt5 mt6 mt7 mt8 mt9 Wt a. How many complementation groups did you identify? For each complementation group, indicate which mutants belong to that complementation group. ++ I++++ + + + + 主+
6) If you had the ability to do gene editing with ONE gene for the betterment of human kind, which one would you choose, and why? Assume you could either change an abnormal allele associated with a disease, such as the cystin gene associated with Cystic Fibrosis to its normal wild type, or add a pre-existing human allele to a genome
15. The CRISPR/Cas9 system provides a form of adaptive immunity in bacteria. We discussed in class that it can be used in human cells to: A: Protect cells from infection with viruses B: Kill cells that carry a specific deletion C: Give cells a memory of the viruses that have infected them D: Greatly enhance the frequency of homologous recombination at a chosen I locus E: Kill cells that have not undergone the desired genome edit
4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence
2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 3'тTGCATССGAAАCGTACGATCGATCGGCCGACTТАТТАСGАТСGGACTAфTGCGTCсTAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'... (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i).
2. Agarose gel electrophoresis of PCR products from samples taken from a healthy, a carrier, and an affected individual revealed DNA bands of different sizes. Please indicate what sample correspondingly belongs to healthy, carrier, and affected individuals, if you know that a shorter abnormal DNA fragment is obtained as a consequence of nonsense mutation. DNA marker 1 1000 bp- 750 bp Sumem 400 bp- CHOGA
8. Using recombinant DNA techniques (which willbe described in Chapter 9), it is possible to take theDNA of a gene from any source and place it on achromosome in the nucleus of a yeast cell. Whenyou take the DNA for a human gene and put it into ayeast cell chromosome, the altered yeast cell canmake the human protein. But when you remove theDNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome inthe nucleus, the yeast cell cannot synthesize the correctprotein, even though the gene comes from the sameorganism. Explain. What would you need to do to ensurethat such a yeast cell could make the correct protein?