. A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown below. Only one of the Cys has a free - SH group and the other two are involved in an -s-s- bond. A Phe Cys « N-terminus Cys- - Met Cys- C-terminus The only methionine and the only aromatic amino acid (Phe) in this protein are in the positions indicated. Cleavage of the intact protein (i.e., with disulfide bonds intact) by either cyanogen bromide or chymotrypsin does not break the protein into two peptides. Where is the -s-s- bond (i.e., AB, BC, or AC)?
Q: A peptide with the sequence isoleucine1-aspartate2-valine3-lysine4-proline5-glutamate6 is located at…
A: Amino acids combine to form proteins by the formation of peptide bond. Amino acids have a one amino…
Q: 8. Predict the effect of each of the following environmental changes on the pKa of a glutamate side…
A: The proteins are made of twenty naturally occurring amino acids. Alpha carbon of amino acids consist…
Q: Two peptide segments are shown below. Predict which one would have the most negative AG when going…
A: Protein folding is a spontaneous reaction by which most of the proteins fold inside the cell without…
Q: Secondary (2°) structure in proteins refers to two specific conformations a region of a protein can…
A: Secondary structure refers to regular, recurring arrangements in space of adjacent amino acid…
Q: Determining the amino acid sequence in a protein usually in- volves treating the protein with…
A: Treatment of a polypeptide with eleven amino acids with one reagent gives the following fragments :…
Q: Using protein leptins' primary, secondary, and tertiary structure, explain your understanding on…
A: Major hormones are proteins or peptide hormones, which are mostly water soluble. Leptin is a…
Q: Determine the mechanism and base change(s) which resulted in the alteration of the sequence of a…
A: In genetics, the mechanism of base change is defined as the change or replacement of DNA single base…
Q: novel protein is described that functions best at pH 10.5, and contains a beta strand on one side.…
A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four levels…
Q: 3. Below is a polypeptide with an unknown number of amino acids. (Standard 4) One the diagram below:…
A: Since you have posted multiple questions with multiple sub-parts, we will solve the first three…
Q: 1. Which of the following structures could the following polypeptide form? And why? The non- polar…
A: A polypeptide is an amino acid polymer that is held together by peptide bonds. Amino acids have…
Q: 3. Below is a polypeptide with an unknown number of amino acids. (Standard 4) One the diagram below:…
A: A peptide is polymer of amino acids linked by a peptide bond. A peptide bond is formed due to…
Q: SYNZIPS are a-helices that can be used in synthetic biology to create coiled-coil interactions…
A: Secondary structure of protein describes the special arrangement of its main chain atoms, without…
Q: 6. Peptide bonds link many amino acids into chains of subunits that make polypeptides, or proteins.…
A: Peptide bond Peptide bond is a type of covalent bond present in between two molecules of amino…
Q: Which statements are true? Explain why or why not.1 Each strand in a β sheet is a helix with two…
A: As per our honor code, we are authorized to answer one question at a time, since you have not…
Q: A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3…
A: Amino acids are organic compounds that combine to form proteins. Amino acids and proteins are the…
Q: Consider the hypothetical serine protease, which shows the specificity pockets. The S, pocket has a…
A: Serine proteases are a family of enzymes that are capable of cleaving peptide linkage of proteins.…
Q: nich snows tne specincity poCkets. Ine Si pocket nas a utamic acid in the bottom, the S2 pocket is…
A: Protease hydrolyses the peptide bond between the amino acid of a polypeptide chain.
Q: What makes the protein folding process mysterious? X: There appears to be no intermediate states of…
A: What makes protein folding process mysterious?
Q: 46. The SH2 protein domain has 2 binding sites: one for ________ and one for _________. A.…
A: SH2 domains are protein modules which take part in the tyrosine kinase signaling pathways. These…
Q: Choose if it's true or false Different from RNA since in the latter the internucleotide linkages…
A: Nucleic acid is of two types DNA and RNA. They are the polynucleotide. Each nucleotide is made up of…
Q: A protein with which of the following sequences may be more prone to undergo farnesylation? (a)…
A: Prenylation (or lipidation) is a process of "post-translational modification" (PTMs) of proteins by…
Q: Consider the hypothetical serine protease in the image, which shows the specificity pockets. The S,…
A: Proteases: These are enzymes that cleave peptide bonds of an amino acid chain of the protein. In…
Q: have simply replaced hydrogen bonds with water in the unfolded protein, yet they critical to…
A: In the year of 1936, The beginning of the study on the structure of globular proteins when comes…
Q: Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic…
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…
Q: Changing one amino acid within a protein sequence from a tryptophan to a stop codon would be best…
A: Mutation is the change in the nucleotide sequence of the DNA that causes a change in the mRNA.…
Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Mutations in proteins do not always lead to a drastic effect on a protein's function. Substitutions…
A: There are 20 amino acids and all are coded by the triplet codons but the overall proteins structure…
Q: Please don't copy Chemistry All of the following tend to favor a helical conformation of a single…
A: Introduction: A longer nucleic acid is called a polynucleotide. It is a biopolymer composed of…
Q: -In a protein, the amino acid pairs below are near each other in the tertiary structure. For each…
A: (Comment: As per the guidelines, we are allowed to answer one question at a time, so I am answering…
Q: You have discovered a novel protein that has a pI = 5.5. To study the functional properties of this…
A: Isoelectric Point (pI) is a condition at a particular pH where the amino acid is present in the…
Q: You have discovered a novel protein that has a pI = 5.5. To study the functional properties of this…
A: The functional properties of the new protein, has two amino acid changes—namely, a surface Phe…
Q: A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3…
A: Proteins are macromolecules formed by amino acids. A total of 20 different amino acids exist in…
Q: Consider the hypothetical serine protease below, which shows the specificity pockets. The S, pocke…
A: As the name suggests that Serine protease is an enzyme that breaks protein-peptide bonds through…
Q: Look at the schematic illustration of a protein (3D conformation) belpw. If the highlighted SER…
A: Proteins are the biomolecules that are made up of Aminoacids joined by Peptide bond. Proteins exist…
Q: In relation to the peptide sequence that is presented. -Gly - Ser – Cys – Asp – Glu – Arg – Cys –…
A: The given peptide sequence contains 8 amino acids. In a peptide, individual amino acids are joined…
Q: You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this…
A: pI of protein is directly proportional to the pKa of amino acids.
Q: V-B. Which of the following peptides would be more soluble at the indicated pH? 1. (Gly)20 or…
A: The 20 amino acids are classified into the following classes based on their R groups:…
Q: 1. A protein has a tertiary structure formed by interactions between the side chains of the…
A: The tertiary structure of a protein is stabilized by noncovalent interactions like hydrogen bonding,…
Q: Which of the following statements best describe(s) the mechanism by which correct protein folding…
A: Chaperonin GroEL/GroES is a molecular chaperone that facilitates folding of nascent or denatured…
Q: involving the amino acid side chains of the polypeptide. Which has the largest effect pilized by a…
A: The tertiary structure of the protein is the three-dimensional conformation of the protein. It is…
Q: why this position in your protein is important and outline the effects the mutation will have on the…
A: Function of 3GRS: Glutathione acts as an important antioxidant in your body. That means it helps…
Q: What is the difference between a peptide and a protein? 2. What type of bond is the peptide bond?…
A: Amino acids are the organic compounds that serve as monomers of protein. An amino acid is composed…
Q: There is parts A-D for the picture provided. A) A peptide has the sequence,…
A: The pKa is the negative value of the logarithm of Ka. The pKa of the ionizable groups of an amino…
Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…
A: Heat shock protein 90 (Hsp90) is defined as a molecular chaperone that is needed for the stability…
Q: Calculate the percentage of the protein molecules in which that tyrosyl residue's phenolic hydroxyl…
A: Tyrosine is an essential amino acid. It is a hydroxyl containing aromatic amino acid. It has three…
Q: Denaturation is basically the dis arrangement of intramolecular interactions in a tertiary structure…
A: 35. True, Denaturation is a process in which proteins lose their native conformation i.e. normal,…
Q: we were to begin with protein that is 145 residues long, How many (ATP/GTP) would have to be used?…
A: Protein synthesis is the complicated and complex process which involves activation of each amino…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Understanding the Relevance of Chaperones in Protein Folding Protein molecules, like all molecules, can be characterized in terms of general properties such as size, shape, charge, solubility/hydrophobicity. Consider the influence of each of these general features on the likelihood of whether folding of a particular protein will require chaperone assistance or not. Be specific regarding just Hsp7O chaperones or Hsp7O chaperones and Hsp60 chaperonins.A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown below. Only one of the Cys has a free –SH group and the other two are involved in an -S-s- bond.Changing one amino acid within a protein sequence from a tryptophan to a stop codon would be best classified as Amino acids groups Group Characteristics Names Ala, Val, Leu, Ile, Pro, Phe Trp, Met Ala: A Leu: L non-polar hydrophobic Arg: R Asn: N Lys: K Met: M Asp: D Cys: C Gly: G polar hydrophilic (non-charged) Gly , Ser, Thr, Cys, Tyr, Asn Gln Phe: F Pro: P Ser: S acidic negatively charged Asp, Glu Glu: E Gln: Q Thr: T His: H lle: I Trp: W Туr: Y Val: V basic positively charged Lys, Arg, His A) Conservative missense O B) Nonsense O C) Neutral O D) Non-conservative missense
- A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown here. Only one of the Cys has a free —SH group, and the other two are involved in an —S—S— bond. The only methionine and the only aromatic amino acid (Phe) in this protein are in the positions indicated. Cleavage of the intact protein (i.e., withdisulfide bonds intact) by either cyanogen bromide or chymotrypsin does not break the protein into two peptides. Where is the —S—S— bond (i.e., AB, BC, or AC)?Which amino acid sequence will form part of which protein structure, and why? Sequence 1: Ser-Phe-Gln-Val-Lys-Leu-His-Tyr-Asp-Val Sequence 2: Glu-Tyr-Leu-Asn-Phe-Ala-Gln-Val-Leu-Arg __Amphipathic beta strand __ Amphipathic alpha helixwnich snows tne specinicity pockets. The S pocket nas a Ra glutamic acid in the bottom, the S2 pocket is small and hydrophobic, and the S,' pocket is deep and hydrophobic. Suggest a 3-amino acid sequence that this protease would R2 H cleave and indicate between which sites the peptide bond would be broken. S2 Which sequence would this protease cleave? Val-Lys-Phe Phe-Lys-Val Lys-Phe-Val Val-Phe-Lys Phe-Val-Lys O Lys-Val-Phe The peptide bond that is broken is between which sites? O S2 and S,' OS, and S,' O S2 and S1 O S2 and S1, and S and S,' IZ
- An a helix would be destabilized MOST by ○ a glycine residue adopting alpha-helical backbone dihedral angles ○ interactions between neighboring Asp and Arg residues ○ interactions between two adjacent hydrophobic Val residues O the presence of an Arg residue near the carboxyl terminus of the a helix O the presence of two Lys residues near the amino terminus of the a helixUpload a drawing of Gly-Met-Asn-Glu-His Label the alpha carbons Label the R groups as hydrophobic or hydrophilic Label the acidic and basic R-groups Label the peptide bonds Label the N terminus and the C terminus18 The image below shows the different interactions responsible for the spontaneous folding of a protein molecule. Identify which interactions are involved for each labelled region 0-H H CH,OH CH, NH, 0 B O-H--OO CH, CH₂ A B D C A यह मह CH CH₂COOH C H CH, CH, CH, CH H--O=C D T (CHJANH, - interactions ion-dipole interaction Hydrogen bonding Hydrophobic interactions Disulfide bonds lon-ion interaction 18
- Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopBelow is the primary structure of a protein. A R 1 I I H H || O H 1 Psi bond [Select] Phi bond [Select] N-terminus [Select] B C D H O I || C-terminus [Select] NC-C-N-C-C-N-C-C-N-C-C-N-C-C - N... I 1 H H I R R H I 11 O HO I || R R I I H a. For each part of the question, select the letter associated the with appropriate component of the structure. Peptide bond [Select] I H U MO b. Which letter represents a bond without 360-degree rotation? [Select] H |N. HN H3N Where on this amino acid does it attach to a primary sequence of a protein and where is the ionizable position of the R group?