You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter regions, where the RNA polymerase II and transcription factors would bind THERE ARE MULTIPLE ANSWERS THAT YOU CAN CHOOSE From the list given - choose all components that you think are part of a typical eukaryotic gene Group of answer choices A core promoter B 3'UTR C introns D enhancer E coding sequence F mediator protein G PPE H exons I DNA-bending protein J 5'UTR
Q: Describe the difference between a transcriptional fusion and a translational reporter gene fusion.…
A: Transcription fusion means cloning the promoter of interest, upstream of any transcription unit,…
Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…
A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…
Q: Consider the following mRNA molecules and the amino acids they code for. The second mRNA molecule is…
A:
Q: Which of the following is a property or characteristic of eukaryotic promoters? O They contain the…
A: Promoters in transcription are actually certain specific sequences of DNA that define the starting…
Q: The insertion of transposable elements into genes can alter the normal pattern of expression. In the…
A: NOTE:- As you have posted multiple questions under one, we will solve the first part for you, to…
Q: . You are analyzing two different cells that transcribe the same gene called neurexin (NRXN). The…
A: Hi dear, here's your answer.
Q: D D Intron +1 E E A В В C GGGCGG GCCCAATCT TATAAA Intron -5000 -100 -25 1. What region functions…
A: The transcription is the process of conversion DNA to RNA . DNA stands for dioxy ribonucleic acid…
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: During mutation, there is a change in the overall sequence of the gene, which can result in a change…
Q: Genes can be transcribed into mRNA, in the case of protein coding genes, or into RNA, in the case of…
A: Transcription unit refers to the part of the gene that code for a protein.
Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…
A: Ans... a base substitution in an enhancer region
Q: Below is a diagram oT a gene that is not normally alternatively spliced. All Tour exons (represented…
A: Any change in a single nucleotide of a gene is called a point mutation.
Q: Transcription is thus the final stage of gene expression involves interactions between three types…
A: Transcription is copying down of information from DNA to RNA. The final stage that involves gene…
Q: Explain how transcription regulators in eukaryotic cells are able to act at a great distance from…
A: DNA is a nucleic acid present in the nucleus of the eukaryotic cells.
Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: 5.Below is schematic of gene Z, which encodes for protein Z. the promoter is indicated by the dotted…
A: Given information In the diagram , there are Exon 1, Exon 2 and Exon 3. There are two introns 1 and…
Q: You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate…
A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…
Q: In eukaryotic gene regulation, the Mediator complex mediates interactions between: The preinitiation…
A: Mediator complex found in Drosopila , mammals and yeaat. It interact with transcription factor…
Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…
A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…
Q: The following are examples of how eukaryotic cells may control gene expression small RNA molecules O…
A: Eukaryotic genome is huge and consists of millions of base pairs. The eukaryotic genome is highly…
Q: The following are examples of how eukaryotic cells may control gene expression O small RNA molecules…
A: The process by which the information stored in a gene is used to control the assembly of a protein…
Q: 5
A: The correct answer is A.
Q: silence genes
A: Gene silencing is a mechanism that regulates gene expression to define cell fate and also regulates…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: The incorporation of a foreign gene into E. Coli genome and its expression is the process of genetic…
Q: A human gene was initially identified as having three exons and two introns. The exons are 456,…
A: A)
Q: A eukaryotic gene typically has all of the following features except O A5' UTR An operator O A…
A: Eukaryotic genes are regions of DNA that act as templates for the production of RNA by RNA…
Q: The diagram below depicts an active transcription bubble after a short period of RNA synthesis…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: Expression of eukaryotic gene in prokaryotic organisms like bacteria convey several challenges. The…
Q: Please answer fast Consider that sequencing identifies the grumpy gene in your Illumina $1200…
A: Illumina enables scientists to analyze the entire human genome in a single sequencing experiment, or…
Q: w is the diagram of a eukaryotic gene that encodes a protein. The promoter and n start sites are…
A: Post transcriptional modification removes introns and add existing exons together in the primary RNA…
Q: These are written as either accurate or contain errors. Rewrite each one with an error as an…
A: RNA polymerase is an enzyme responsible for the copying a DNA sequence into RNA sequence. That means…
Q: A researcher is trying to identify regulatory DNA sequences near a gene of interes- Several modified…
A: An enhancer is a a short region of DNA that when present either upstream or downstream of a gene can…
Q: Eukaryotes can control transcription by three overall type of process, they are ( selection from…
A: The regulation of transcription is more complex in eukaryotes as compared to prokaryotes. This…
Q: A human gene was initially identified as having three exons and two introns. The exons are 456, 224,…
A: Part A.
Q: Match these transcription-associated terms with the appropriate definition or function. DNA sequence…
A: The transcription of DNA occurs in 3 major steps, initiation, elongation and termination. The…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: Gene expression It is defined as the process through which the nucleotide sequence of the gene is…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: Gene expression is a phenotypic expression of genes through writing and translation processes.…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: The process of transferring genetic information from the DNA into the RNA molecule is called…
Q: From the list given - choose all the regulatory sequences that you think would control the…
A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…
Q: Think of the eukaryotic gene expression process. Which column below accurately describes which…
A: RNA polymerase is a molecular enzyme that synthesizez RNA molecule from a DNA template. RNA…
Q: Label these processes 1-8 (1 being the earliest time point) in the order they would occur during…
A: DNA is the molecule which stores the genetic information. Genetic information in the DNA is first…
Q: a. What is grey donut shaped object supposed to represent? b. Label with the word "promoter" where…
A: Transcription is the first step of the central dogma, it is a process where an RNA transcript is…
Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An…
A:
Q: This is a list of molecular changes that could happen during DNA replication, transcription, mRNA…
A: The mutation alters allele frequencies by constantly introducing new alleles, which can be…
Q: Shown is a segment of DNA with its promoter and terminator. Start and end of transcription are…
A: Transcription is the phenomenon in which one stranded RNA is synthesized from DNA strand . But RNA…
Q: In eukaryotic gene regulation, transcription is regulated by the following EXCEPT a. the binding…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: A mutation has occurred to a wild type mRNA sequence: Wild Type: 5’-AUG-UUG-CAA-GCG-3’ The new…
A: A mutation is a change in the nucleotide sequence of the DNA of an organism. Mutations can be caused…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: Given: This piece of genetically engineered DNA (represented by the schematic in the figure)…
Q: Which of the following parts of the eukaryotic promoter are bound by general transcription factors?…
A: As visible In image GTF general transcription factor bind to core protein , proximal elements
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18…
A: Transcription is the process of creating new RNA by duplicating the DNA strand. Transcription is the…
You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter regions, where the RNA polymerase II and transcription factors would bind
THERE ARE MULTIPLE ANSWERS THAT YOU CAN CHOOSE
From the list given - choose all components that you think are part of a typical eukaryotic gene
Step by step
Solved in 2 steps
- The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.Shown below is an eukaryotic gene. Assuming normal wild type RNA processing in a.cell, which of the following mature MRNAS could result in normal levels of functional synthesized proteins? Select all that apply Direction of transcription Promoter Template strand 5' Exon 4 Intron 3 Exon 3 Intron 2 Exon 2 Intron 1 Exon 1 3' 5' Coding strand Transcription start Transcription start 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA...AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4 Exon1-Exon2-Exon3-Exon4-.....AAAA
- From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene THERE are multiple answer for this that I can choose Group of answer choices A 3' UTR B PPE sequences C 5' UTR D introns E core promoter F coding sequence G DNA-bending protein H enhancer sequence I mediator proteinFrom the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression THERE ARE MULTIPLE ANSWER TO THE QUESTION Group of answer choices A RNA polymerase II B 3' UTR C mediator protein D 5' UTR E activators F coding sequence G specific transcription factors H general transcription factorsBelow is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
- Where does transcription take place? nucleus cytoplasm ribosome mitochondria Why must transcription occur where DNA can be found? because DNA can't leave because ribosomes are in the nucleus because DNA polymerase is found there because helicase unzips the DNA How many nucleotides equal 1 amino acid? 1 3 TRANSCRIBE this DNA sequence: TACGTTACT AUGCAAUGA ATGCAATGA AUGGATUGA TACGTTACT É O O O O O O O OThink of the eukaryotic gene expression process. Which column below accurately describes which components of the gene are translated by ribosomal complex? Component A В D Ribosomal binding site Yes No No Yes Promoter Yes Yes No No Exons Yes Yes Yes Yes Introns No Yes No No C O ATranscription Translation stop site start site Intron 1 Promoter Exon 1 Exon 2 Intron 2 Exon 3 | Transcription stop site What kind of mutation would you introduce to render the gene above such that it is expressed with a normal functioning protein, but less protein produced overall compared to the non-mutated gene? Explain in 1-2 sentences, including where the mutation would be located.
- Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will be transcribed? Or which regions will be part of the new RNA molecule that is synthesized during transcription? Select all that apply. Promoter Intron Exon Transcription stop sile Transcription start site 5- 31 ATG 75 TAC TAA ATT 3' 5' 50 100 300 200 228 50 3' 5' Start Splice donor codon Splice аcсeptor Splice acceptor Splice donor Stop codon Exons Ribosomal binding site Promoter IntronsModifications of histone tails can: O repress the transcription of some genes affect chromatin structure affect the transcription of some genes in response to the diet or environment activate the transcription of some genes all of these choices are correct The ferritin gene encodes an IRE (Iron-response element) within the 5 UTR (untranslated region) of the MRNA Considering what you know about eukaryotic translation, the IRE-BP (Iron Response Element Binding Protein) is bound to the IRE in the 5'UTR. you would expect: O That the presence of the IRE-BP would enhance translation. That the presence of the IRE-BP would have no effect. That the presence of the IRE-BP would block translation I don't remember enough about the IRE-BP or transiation to guess. 3 Assuming that the trait represented by the filled symbols in the pedigree is an inherited trait due to a single gene with alleles A and a, what mode of inheritance does the pedigree shown suggest?a QUESTION 7 Please read the paragraph regarding transcription termination and fill in the blanks with words from the word bank below (not all of the words will be used): Rat1 ATP Adenosine AAUAAA Rho TATA A-site RNA polymerase Uracil Rut site Guanosine Hairpin There are two known mechanisms of transcription termination in prokaryotes. One mechanism requires a protein complex called This protein complex binds to the which is located on the RNA that is being transcribed. This protein complex then moves toward the stalled RNA polymerase complex and unwinds the RNA from the DNA. A second mechanism for termination in prokaryotes requires an RNA termination sequence that contains a secondary structure called a followed by a string of nucleotides. Transcription termination for RNA Polymerase II in eukaryotes happens when the termination consensus sequence, is transcribed leading to cleavage of the mRNA 11-30 nucleotides downstream of the termination sequence. Once cleavage occurs, binds to…