write out a detailed summary on Salmonella. Questions below will help you frame your summary. Please describe the bacterium. What is its shape and size? Is it Gram-positive or negative? Pictures are always fun! If you can find a microscopic image – include it. What is/are the reservoir(s)? e.g. water, food, human, etc. Are there parameters needed for infection? (Temperature, pH)
Q: pea color and coat texture are independent traits in pea plants. Yellow (G) is dominant over green…
A: Dominant character is always expressed in homozygous as well as heterozygous condition. On the…
Q: Mr Ojomu is a 42 year male of African origin. He has a demanding desk-based job and frequently has…
A: Mr Ojomu is a 42 year male of African origin. He has a demanding desk-based job and frequently has…
Q: Explain how the vertical concentration gradient in the medulla and the concentration of vasopressin…
A: Vasopressin: Vasopressin, also known as antidiuretic hormone (ADH), arginine vasopressin (AVP), or…
Q: Using concept of homeostasis, explain how the kidneys are involved in controlling fluid osmolarity.
A: Introduction:The kidneys regulate the volume and osmolality of the extracellular fluid by changing…
Q: Why are proteins important for cells? A - They are the main source for energy inside cells. B - They…
A: Proteins are large biomacromolecules that are made up of one or more amino acid chains. The…
Q: 5. Discuss the differences in plant diversity and explain how the changes affect the animal species…
A: Biodiversity: Biodiversity is rapidly dwindling over the world, and scientists agree that this will…
Q: C4 and CAM plants are more efficient than C3 plants beca a. reduce O2 concentration. b. have no…
A: C4 plans are more efficient than C3 plants because C3 plants have no special features to combat…
Q: Scientists have also noticed unusual coloration among certain condor populations. Andean condors are…
A: The Andean condor (Vultur gryphus) and the California condor (Gymnogyps californianus) are two of…
Q: The principle that species cannot occupy the same niche forever, one will eventually exclude the…
A: Introduction A species' ecological niche is described as the role or position that it plays in its…
Q: story TIME rition Facts i During this pandemic time, the government does not allow ! senior citizen…
A: Nutrients are molecules and substances that nourish the body for proper growth and development.…
Q: Locate the dogfish shark muscles based on the summary of its origin, insertion and action. Table 1.…
A: The spiny dogfish shark, Squalus acanthias, belongs to Chondrichthyes, which first appeared in the…
Q: 1. List 3 to 5 kinds of animals that belong to the same group that may differ in appearance. 2. Are…
A: Animals are eukaryotic organisms that play a major role in the ecosystem. They feed on organic…
Q: 2. Using the standard 3.6 amino acids per turn (360°) and the helical wheel below, plot each…
A: A helical wheel, which is a visual representation of amino acids, represents the alpha-helices in…
Q: What structure is represented by 3 on the diagram? -5 Koopa -6 1 -4 3 |- PJ PG 9 7 7 7 7 7 7 7 7…
A:
Q: LEAF PIGMENTS
A: Introduction Plants produce a significantly greater range of pigment compounds than animals. Plants,…
Q: Compare the male and female reproductive organs of reptiles and birds. Explain how are their…
A: Introduction Reptiles are cold-blooded animals that have vertebral columns at their backs. These…
Q: Provides support and nutrition to neurons, as well as influences nociception. Cellulose Myelin…
A: Glial cells is a common term used for many types of cells like astrocytes, microglial, Schwann…
Q: Supposing two strains of autotetraploid plants are available and their genotypes are as follows.…
A: Tetraploidy (four sets of chromosomes, 2n = 4x) is common in many plant species, and also occurs in…
Q: A measure of the productivity of photosynthesis is the rate of a. water production. b. heat…
A: d) Oxygen production .
Q: iss Smith is a 17-year-old female who is studying for her A-Levels at sixth form college and has a…
A: A digestive system consists of the GI tract that includes organs such as the mouth, pharynx,…
Q: Why is there a debate as to whether archaea is classified as prokaryotic or eukaryotic
A: Introduction Single-celled organisms are classified as Archaea. Prokaryotes are microorganisms that…
Q: dredging
A: Dredging impacts marine organisms negatively through entrainment, habitat degradation, noise,…
Q: Which of the following statements is true regarding cell cycle regulators? a. Cyclins determine…
A: Cell cycle doesn't occur in unchecked manner. Cell preperation is usually checked by regulatory…
Q: How many steps (inhalations/exhalations) are needed to complete one ventilatory cycle in birds? 3…
A: Introduction Inspiration (or inhalation) and expiration (or exhalation) are the two phases of…
Q: Using the Concord Consortium interactive, observe how mutations can affect protein formation and…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by…
Q: silence genes
A: Gene silencing is a mechanism that regulates gene expression to define cell fate and also regulates…
Q: Using ALL of these terms: antigen antibodies plasma erythrocvte please describe WHY a person with B-…
A: B blood group has antigen B(agglutinin) and antibody anti-a ( agglutinogen) . AB blood group has…
Q: 2.3 7 (a) Describe what happens when each of the following molecules is separately dissolved in…
A: ACIDS AND BASES Acids are substances that carry hydrogen and are capable of donating protons to…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…
A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…
Q: chromosomes
A:
Q: To determine: The three classes of the amino acids which are likely to be important for the…
A: Proteins are usually defined that they are about to refer as they are necessary for the human body…
Q: What is the evolutionary trend in the alternation of generation in plants? Elaborate on adaptive…
A: Alternation of generation also known as metagenesis or heterogenesis in biology the alternation of a…
Q: Specimen: Chicken Bones Lumbar and sacral vertebrae: There are several bones in synsacrum (made up…
A: Please follow step 2 for detailed explanation.
Q: An exponentially growing bacterial population increases its number from 10³ and reached 10 cells in…
A:
Q: Which of the following are the purposes of protein synthesis? A - Protecting bacteria from…
A: Protein synthesis is very much important process in the cell. All enzymes are constituent of…
Q: . Compute the WBC count of undiluted CSF of 56 total WBC counted in 4 squares.
A: A CSF cell count is a test to measure the number of red and white blood cells that are in…
Q: Which of the following does NOT pertain to the myoblast-determining gene 1?* a. It is a master gene.…
A: Developmental biology describes how interacting mechanisms generate an organism's various size,…
Q: What is the effect of light on microbial growth?
A: Introduction:- The quantity of bacteria in a population, rather than the size of individual cells,…
Q: In humans the wall of the left ventricle is thicker than that of the right ventricle. This…
A: Cardiovascular system The circulatory system is also referred to as the cardiovascular system. It is…
Q: How Alamanda Cathartica helps to prevent the lice on hair?
A: Alamanda Cathartica It is also called golden trumpet. It is a flowering plant which produce…
Q: How smoking can lead to Rheumatoid arthritis?
A: Rheumatoid arthritis Rheumatoid arthritis is a disorder in which the pain and immobility of joints…
Q: Age Interval (decades) 123 + 2 4 Proportion of surviving to beginning of age interval 1 0.2 0.04…
A: A life table is a summary of a population's survival and reproductive rates, broken down by age,…
Q: Create a list of two potential threats to biodiversity in your immediate area and describe their…
A: Introduction Biodiversity:- It is all the different kinds of life you'll find in one area, it is…
Q: When the ambient (room) temperature is very high, the human body will lose heat by
A: Thermoregulation in humans is an important aspect of homeostasis. Humans have been able to adapt to…
Q: 2. Symbiosis. Describe the interaction of species by supplying Species A and B with proper…
A: Symbiosis is a close and long-term association between two individuals of different species and as a…
Q: Which of the following would be considered a primary role of the large intestine? O Increase the…
A: Large intestine has 3 primary functions : Absorbing water and electrolytes Producing and…
Q: 2.1 5 (a) Define an acid and a base according to Bronsted-Lowry An acid is: A base is: (b) Explain…
A: Introduction :- Count the hydrogens on each component before and after the reaction to determine if…
Q: The structure of the C4 leaf shows how mesophyll cells hug the epidermis of the leaf. hug the bundle…
A: Photorespiration is a wasteful pathway that occurs when the Calvin cycle enzyme rubisco acts on…
write out a detailed summary on Salmonella. Questions below will help you frame your summary.
- Please describe the bacterium. What is its shape and size? Is it Gram-positive or negative? Pictures are always fun! If you can find a microscopic image – include it.
- What is/are the reservoir(s)? e.g. water, food, human, etc.
- Are there parameters needed for infection? (Temperature, pH)
- What is/are the mode(s) of transmission. If it's foodborne - is it linked to a specific food?
- How many cases occur each year? In the US and/or worldwide and/or in the County where you live
- Has it caused any outbreaks or epidemics?
Thank you-
Step by step
Solved in 4 steps with 1 images
- Write the process/steps in Preparation of Bacillus atrophaeus culture using Blood agar plates and MacConkey agar plates. Note: This will perform the students so please write it in the easiest manner. 5-10 sentences only ThanksHelp me, please! I wish I have a lot of time to do it by myself ... This is the article link and a microbiology open Stax book link for chapter 16 terms. Please help me to find answers. https://piercemil.instructure.com/courses/2180982/assignments/24927088 https://openstax.org/books/microbiology/pages/15-2-how-pathogens-cause-disease#OSC_Microbio_15_02_Invasion Questions: If possible please write the pg of an article with related Answers; it will be easier for me to describe in detail. Thank You for Helping me. Using the terms found in the “Patterns of Incidence” subsection in Chapter 16, what pattern of incidence best matches the outbreak described in the article? Using the terms found in the “Pioneers of Epidemiology” subsection in Chapter 16, which discusses “spread”, what type of spread of the pathogen best matches the outbreak described in the article? Be specific. What type of epidemiological study was used to identify the source of the pathogen in the article? Be specific.…4. Figure 1 (see next page) depicts the timeline of Sammy's chlamydia infection. Each panel of the figure represents a blood sample, showing a stain of the chlamydia bacteria. The red dots indicate the initial chlamydia bacteria, and the yellow dots indicate the mutated chlamydia bacteria. Provide detailed captions for the images under the titles, specifically indicating how the bacteria population changed over time. "The Fight Against Bacteria" by Jessie M. Garcia Page 3 NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Figure 1a. Initial chlamydia infection. Figure 1b. Three days into the doxycycline treatment. Figure 1c. Sammy stops taking her antibiotic pills. Figure 1d. One week after the doxycycline treatment. Figure 1e. Two weeks after the doxycycline treatment.
- Please write, in paragraph form, how you would identify the organism step by step. Remember to provide as much detail as possible, including but not limited to staining procedures, identification methods and their results. You have been given the final answer (type of organism), now explain to me in detail how you would come to this conclusion Type of organism Topic is : Proteus vulgarisAs a medical microbiologist, if you are presented with a patient suspected to have a bacterial disease, describe the various steps you would follow, to establish a laboratory diagnosis. Please keep brief - 8 sentences/dot points max.Please reply to the post below whether or not you agree or disagree and why A common microbe found in foods and can be taken orally are probiotics. Probiotics are live bacteria that balance good and bad intestinal bacteria and aid in digestion or digestive problems. For example, Lactobacillus species habituate where rich carbohydrate substances are available including the human digestive and urinary tracts. In 1900 lactobacillus acidophilus was isolated by Moro from infant feces and the intestinal tract of animals and humans. Also, it was reported in the feces of milk fed infants and older persons consuming high milk/lactose diets. This microbe is also found in plant materials and agricultural products particularly milk, cheese, fermented milk products and beverages such as wine and cider. Historically, Lactobacillus species is most often known to be capable of eliciting beneficial effects on the microbiota of the gastrointestinal tract. It helps the body break down food, absorb…
- Write the process/steps in Preparation of Bacillus atrophaeus culture using Blood agar plates and MacConkey agar plates. Note: This will perform the students so please write it in the easiest manner. ThanksMICROBIOLOGY: Microscopic Morphology of Microbes Write your introduction (This includes principles, significance of the study, objectives of the experiment and how the objectives were achieved. This part must also be in the passive voice and past tense. Introduction must be short but packed with relevant content). another: What is the advantage of the Gram stain over the simple stain? What is the theory about the mechanism of the Gram-stain reaction?Write process/steps on how to culture the bacillus athropaeus. Note: please write it in the easiest way on how to culture the bacillus athropaeus because students will actually do it. Thanks! 5-10 sentences only.
- Write the process/steps in Preparation of Bacillus atrophaeus culture using Blood agar plates and MacConkey agar plates. Note: This will perform the students so please write it in an easiest manner. ThanklsAnswer the following questions: 1. What was the first antibiotic and what was its importance? 2. What does resistance mean? 3. Who is affected by resistance? 4. What if the resistance problem is not solved? 5. Describe the structure of the bacterium (its parts) 6. Can bacteria change? explain 7. Why do Bacteria communicate, what is the purpose? 8. Explain how a bacterium achieves its resistance. 9. What is the use given to antibiotics in production animals? 10. Is this use in animals good practice? 11. Once resistance occurs, what has the scientific community had to do? 12. Do antibiotics only affect negative bacteria? explain. 13. What are the most feared diseases due to antibiotic resistance? 14. Should antibiotics be used against viruses? explain. 15. How can we avoid antibiotic resistance?Identify: 1. Cell shape and arrangement in A? 2. Gram stain reaction in A? 3. Cell shape and arrangement in B? 4. Gram stain reaction in B? 5. Genus and species of B? (component of the normal flora of the skin)