Which factor sets the lower limit of Balanus' realized range in the intertidal zone? O Ability to withstand dessication Interspecific competition Predation
Q: Use the image below to answer questions 2-3. As part of his series of experiments, Connell removed…
A: Competition When two species compete for the same thing like place, food, water, ect then this…
Q: xplain how the following affect membrane fluidity: – Level of phospholipid tail saturation – Level…
A: A plasma membrane is a selectively permeable membrane. It is made up of phospholipids, proteins and…
Q: Which ( somatic or gametes) are made in the process of meiosis?
A: Cell cycle is a series of events that are responsible for producing daughter cells from parent cell.…
Q: .) What can you conclude about the location of the genetic determinants of R and S? b.) What other…
A: Maternal effect genes or maternal genes are genes whose mRNA or proteins gets deposited onto the…
Q: The following are the conditions that determines the direction of ions as it pass through the…
A: The following are the conditions that determines the direction of ions as it pass through the…
Q: Antonie van Leeuwenhoek was the first person to use a microscope and describe tiny animalcules. What…
A: Introduction : A microorganism is an organism too small to be seen by human naked eyes.…
Q: Binding EGF to the EGF receptor causes phosphorylation of tyrosines on the cytoplasmic tail of the…
A: Tyrosine kinases are essential mediators of this sign transduction process, main to…
Q: Put the following in order in mitosis and the preceding interphase Hint: Determine whether the event…
A: In eukaryotes, Cells divide either via mitosis or meiosis. Somatic cells divide via mitosis.…
Q: The polysaccharides are starch, glycogen, and cellulose. In the chart below, I put an 'X' under each…
A: Carbohydrates are composed of carbon, hydrogen and oxygen. The most simple carbohydrate is the…
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: basic structure of the subunit for each type of cytoskeletal protein and compare and contrast…
A: Cytoskeletal proteins are a group of filamentous proteins that provide structure and support for the…
Q: QUESTION 1 An armadillo with the genotype Ee is used for a test cross. What is the genotype of the…
A: Explanation: The expression "genotype" alludes to the hereditary cosmetics of a creature; at the…
Q: F₁ generation 1. Parents with the following homozygous genotypes for both traits were crossed in…
A: A dihybrid cross involves the mating of individuals having Different variants of the same allele.…
Q: QUESTION 4 In Mendel's pea plants, round shape (R) is dominant to wrinkled shape (r), and yellow…
A: Introduction : Punnet Squares are square-shaped diagrams used to predict genotypes in breeding or…
Q: A = all of the dominant alleles for a particular trait in a specific population; a = all of the…
A: Given, A - dominant alleles a - recesssive alleles A - p and a - q Hardy Weinberg Equation is p + q…
Q: This specialized channel proteins facilitates water transport through osmosis. Spectrins Aquaporins…
A: In facilitated diffusion, the movement of solutes happens via transport proteins that span the…
Q: In the potato osmosis lab experiment what is the point of having multiple potatoes soaking at each…
A: Answer: Osmosis : It is the process of movement or flow of water molecules across the membrane with…
Q: Besides heat shock method, elaborate another procedure commonly used for transformation cell. of a…
A: CaCl2 transformation method Competent cells are the bacterial cells(host) that can accept…
Q: What are the characteristics of a high-quality DNA extract? What do you do to determine the quality…
A: DNA extraction is a protocol used for the isolation and purification of DNA from biological samples…
Q: Do the Paramecium show any signs of being electrically charged? If so, do they carry a positive or a…
A: Paramecium:- this organism belongs to eukaryotes having true nucleus. This is an unicellular,…
Q: Explain cell theory in three sentences.
A: Introduction : A cell is the basic structural and fundamental unit of life. Cells are the building…
Q: What anatomical feature in digestive cells allows more digestion? a. Goblet cells b. More nerve…
A: Digestion is a process involving the breakdown and metabolising of food particles to obtain…
Q: How do potassium ions travel as they move into the cell?A.Up the concentration gradient and up the…
A: Introduction The cell membrane is a structure that surrounds the cell and keeps the organelles…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: Membrane transport The plasma membrane is the semipermeable membrane which allows only selected…
Q: Why is there a need to provide the magnification of a specimen drawn
A: Microscopy is used to visualise the objects such as tissues, cells, nanoparticles etc. which can not…
Q: In a population of 50 hamsters, 60 of the alleles code for brown fur and 40 alleles code for black…
A: If the allele and genotype frequencies remain same generation after generation then we can say that…
Q: What is the purpose of soaking the egg in vinegar? Explain the rationale of vinegar reaction to the…
A: 1. What is the purpose of soaking the egg in vinegar? Explain the rationale of vinegar reaction…
Q: Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.
A: The process of speciation is how populations develop into separate species. When populations are…
Q: Which of the following occurs when red blood cells are transferred from an isotonic solution to a…
A: Many biological subdisciplines exist within cell biology. An illustration of this would be studying…
Q: Why are basic dyes more effective for staining bacteria than acidic dyes
A: Answer: Dyes are the colouring component which are used for many purposes like in microbiology for…
Q: What is Chorioallantoic Membrane?
A: Developmental biology studies how integrating systems produce an organism's diverse dimensions,…
Q: Answer exhaustively, why are the protein receptors on the egg cell particularly important among…
A: Introduction :- A male organism's sperm fertilises a female organism's egg outside of the female's…
Q: Construct a cladogram from the data below. Four Limbs X X Animals Frog Rodent Lizard Gorilla Fish…
A: Cladograms are branching structures that resemble trees and illustrate the shared links between two…
Q: QUESTION7 Tine has type O blood and her sister Rose hes type All blood. What are the blood genotypes…
A: Introduction There are four different types of blood groups are found in human. Blood group A, B, AB…
Q: Why do adult humans have tail bones?
A: Introduction An organism that has attained sexual maturity is said to be an adult. The term "adult"…
Q: QUESTION 4 Although physical features such as teeth are good for classification, only DNA can be…
A: Introduction : A phylogenetic tree, also known as phylogeny, is a picture that shows how different…
Q: Compare the homebased DNA extraction method with the Phenol:Chloroform extraction method.
A: DNA extraction: The process of extraction of DNA from the cell can be done by various methods.…
Q: give their taxonomic classification and describe their unique characteristics
A: Pocillopora damicornisis a genus of stony corals with inside the own circle of relatives…
Q: Amylose Amylopectin
A: Introduction The most prevalent carbohydrates in food are called polysaccharides, or…
Q: Different recommended BMI ranges exist for people of different ethnic groups. This is partially due…
A: Answer : True
Q: Which group (Population A that stayed in the flat territory or Population B that moved to the rocky…
A: Genes are the hereditary units that control specific traits, different versions of these genes are…
Q: Does the removal of Chthamalus affect the distribution of Balanus? Yes No
A: Introduction: Connell carried out a number of studies in which he transferred the barnacles to…
Q: You’ve been noticing that a local pond has developed a green scum that is getting thicker and…
A: Since it frequently causes the degradation of water quality and the reduction of dissolved oxygen in…
Q: If a goose with genotype Aa had migrated instead of the goose with genotype aa, would the scenario…
A: The movement of genes into or out of a population is referred to as gene flow. Such movement may…
Q: If you wanted PCR to be successful but only had access to a thermolabile DNA polymerase, what would…
A: PCR - Polymerase chain reaction, is a process where DNA copies are amplified by a cyclic chain…
Q: species are most broadly distributed, which have the smallest range? List at least 3 names per each…
A: Species of organisms are distributed worldwide according to their adaptation ability and the…
Q: The difference in charge and chemical concentration across a membrane is known as
A: Gradient across membrane:- it represents the movement of molecules or ions across the membrane. It…
Q: Which three proteins participate in movement of vesicles from the plasma membrane toward the…
A: Transport of macromolecules through vesicles:- large molecules usually internalised by plasma…
Q: 1. A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by gel electrophoresis. The…
A: The restriction endonucleus are specific enzymes that are responsible for cutting phosphoruster bond…
Q: It is a solution whose solute concentration is lower than the solute concentration inside a cell.
A: Cell biology is an essential subject that aids in understanding the cell's nature. It is…
Step by step
Solved in 2 steps
- Which factor sets the lower limit of Chthamalus' realized range in the intertidal zone? O Ability to withstand dessication O Interspecific competition O PredationWhich species is the stronger competitor for space in the intertidal zone? O Chthamalus BalanusWhich drawing of the intertidal region correctly represents Balanus' fundamental niche with an oval and correctly represents the Balanus' realized niche with a rectangle? O Image A O Image B Image C O Image D A. B. C. D. Å 4
- I made it payable to bald Eagle’s will typically have a territory of 1-2 km i’m sure line in which they do not tolerate the presence of other members of the species why is it necessary for them to defend Such a length of territory explain in terms of their diet in trophic webAre the impacts of the biotic and abiotic factors of the Spotted Lanternfly short or long term or both? Will Covid be a concern this winter in Ontario Canada
- Thinking about biological magnification of toxins, is it healthier to feedat a lower or higher trophic level? ExplainOn average, how long does it take to adapt to altitudes up to 2300m? 2 days 1 week 2 weeks 3 weeksWhat are the main ecological goods and services provided by seagrasses in both regions Pacific , Islands ,Bahrain and the Arabian Gulf. basedon no-material ?
- K P Parchment Exchange - Leader i edgenuity.com/player/ - SC5181 A 7 1 X Unmark this question + 7 8 What would happen to the ecosystem services provided by a coral reef if it were to sustain permanent damage? O The water that would otherwise filter through the coral polyps would become more dense with plankton. O There would be higher concentration of water pollution that could harm other organisms. O Timber production in surrounding land areas would decrease due to the lack of nutrients in the soil. O Humans would have more reason to visit the area in their boats. O 10 M O DELL ✓ Save and Exit 10 Next G<☆ English Sign out Kinley Heath Submit O A Oct 27 10:17 ATwo species of sea urchins live practically side by side on sandy bottoms. The two species appear to have the same diet: drift seaweedsand other bits of organic matter. They are able to live in the sameenvironment with minimal competition. How might they be able toshare their habitat and food resources?Are higher macroinvertebrate indicators of less or more stream health? Do different invertebrate species have different tolerances to pollutants, thus can be used as an indicator of stream health? does Aquatic vegetation has a greater influence on zooplankton or benthic macroinvertebraes