what are the effects of PSTMB shown and why is it important to show effects of PSTMB in vitro effects of PSTMB on LDHA? https://www.nature.com/articles/s41598-019-40617-3
Q: Is whole milk and apple juice a good dietary fat?
A: Fats are a type of lipids, and lipids are macronutrients, which are required by the body in large…
Q: opinion should be the definite characteristic
A: Life of any organism can be beneficial or harmful depends upon the nature of an organism.
Q: Draw the Haworth Projection or the cyclic structure of the following:
A: organic compound organized in the form of aldehydes or ketones with multiple hydroxyl groups coming…
Q: Which THREE statements are true about targetting proteins to the nudieua? Aln the cytoplasm, a…
A: Nuclear localization signals mediates the transport of proteins from the cytoplasm into the nucleus.
Q: 9. Which of the following changes would not affect a peptide GENSHIN? A. Heat B. Inorganic Salts C.…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: what is the relative activity and the degree of inhibition caused by a competitive inhibitor when…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy.…
Q: efly
A: There are various methods of studying the Enzyme-substrate complex like magnetic resonance…
Q: Amanufacturer of a line of patentmedicines is preparing a production plan on medicines A and B.…
A: Decision variable: A = bottles of medicine A (1000 units) B = bottles of medicine B (1000 units)…
Q: Zidovudine and Stavudine are nucleoside reverse transcriptase inhibitors which consists of a…
A: Nucleoside reverse transcriptase is RNA-dependent DNA polymerase enzyme which synthesizes the DNA…
Q: 2. Isocitrate dehydrogenase is an enzyme of 2 subunits with two active sites, catalyzing the…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: List a physiological emulsifying agent produced in the liver. What role does this substance play in…
A: Hepatocytes produce bile, which would then be altered by the cholangiocytes that line the bile…
Q: Q2. How many ATPs are lost in the oxidation of this fatty acid because it is poly- unsaturated? In…
A: First lets calculated total ATP yield if this 18C fatty acid (FA) was completely saturated. 2 ATP…
Q: 1. What are the different classes of lipids? State their function and identify their chemical…
A: A group of organic compounds includes lipids that are insoluble or poorly soluble in…
Q: ACTIVITY 8.1.3 Complete the table Sphingolipid Ceramide Shiphingomyelin Ganglioside Function Name…
A: Introduction: Sphingolipids are complex lipids molecules that contain sphingosine instead of…
Q: If a woman that takes folic acid decreasing her risk of neural tube disorder does this mostly change…
A: Folic acid is the synthetic commercial form of vitamin B. it plays crucial role in the formation…
Q: Long explanations are NOT NEEDED. Answer only d and e. ATP accounting. Consider 1 molecule of the…
A: Sucrose is a disaccharide composed of glucose and fructose units attached together via a glycosidic…
Q: what happens to the intactness of DNA if extracted DNA fibers were placed in buffer of pH 3?
A: Extracted DNA is generally stored in neutral pH.
Q: ACTIVITY 6.1 Complete the table below Source Example of Carbohydrate Function
A: Carbohydrates are a form of macronutrient that can be found in a variety of foods and drinks.…
Q: Folate deficiency may lead to: a.Megaloblastic anemia b.Neural tube defects c.Microcytic anemia…
A: Folic acid is B family Vitamin. It aids in the formation of healthy new cells in the body. Folic…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Which critical product/s of the light reaction are required for the Calvin cycle? О ATP O NADH O O O…
A: Photosynthesis is divided into light and dark reactions. In photosynthesis carbon dioxide is used to…
Q: Interpret the two chromatograms below. Which of the two chromatograms will provide good sequencing…
A: In Automated DNA sequencing, using a laser the different fluorescent labelled nucleotides at the end…
Q: Some food sources of fat-soluble vitamins are NOT considered to be fatty foods, such as carrots,…
A: non-fatty foods does not means that it does not contain any fats. Infact, non-fatty foods must…
Q: 16. Within the chloroplast, grana are ____. Select one: A. stacks of enfolded thylakoid membrane…
A: A chloroplast is a plastid, which is a source of plant cell organelle. Plastids aid in the storage…
Q: A plant isolate was subjected to qualitative tests to determine the presence of macromolecules.…
A: Qualitative tests detect the presence of specific molecules in a sample solution. There are…
Q: Why do alcohol and water separate in DNA extraction process?
A: DNA extraction is defined as a process that is used widely for carrying out the purification fo DNA.…
Q: - What investigation to differentiate between anemia due to vitamin B12 or folic acid deficiency? is…
A: Vitamin B 12 , is a cyanacobalamin. It is usually produced by the bacteria. There are wide variety…
Q: alse about aminoglycosides Can be used in the treatment of tuberculosis O a. O b. They have activity…
A: Antibiotics known as aminoglycosides treat many serious infections caused by gram-negative…
Q: Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary…
A: Let us first understand the one letter codes for the given nucleotides: A is Adenine T is Thymine…
Q: Which of the following is false? a. Methyl, phosphoryl, adenyl, uridylyl and adenosine diphosphate…
A: Enzymes are basically proteins that are intricately packed inside with the help of intramolecular…
Q: 3. How does dimerization of a receptor tyrosine kinase promotes autophosphorylation of the…
A: The tyrosine kinase-associated receptors contain an N-terminal extracellular ligand-binding domain,…
Q: FOV measured at 100x total magnification is 400 micrometers. What is the FOV at 40X total…
A: Formula to find the unknown field of view if the field of view of the scanning value: Total…
Q: In the spectrophotometer, why is there a need to measure a 'blank' sample? What will happen to the…
A: A spectrophotometer is one of the most frequent tools used by scientists to determine the presence…
Q: Which of the following statements about protein digestion are true? Check all that apply. ► View…
A: Proteins are macronutrients, which act as the building blocks of the body. Proteins can also act as…
Q: Hydrophobic signals after binding to the cell-surface receptors activate downstream signal…
A: Introduction: Cells do not work independently but continuously communicate with each other by…
Q: 97) In order for a retrovirus to be infectious a. The p25 protein is cleaved by the protease enzyme…
A: Introduction: Retroviruses are a family of viruses that are grouped together based on how it is…
Q: ACTIVITY 6.2.4 Give the systematic name of the following cyclic monosaccharides: 1. Name: OH Н OH Н…
A: Monosaccharides are carbohydrates with single sugar unit. The structure of monosaccharides can be…
Q: Polyunsaturated fatty acids a). are solid at room temperature b). have carbon-carbon double bonds…
A: Fatty acids are carboxylic acids with long hydrocarbon chain. There are two types of fatty acids -…
Q: An unsaturated fatty acid produces more energy than the analogous saturated fatty acid. A) True B)…
A: Saturated fatty acids contain hydrocarbon chains that are only linked by single bonds. There are one…
Q: Neutrophils exhibit a respiratory burst of free radicals and strong oxidizers during acute…
A: Free radicals are highly energetic chemical species that go onto react with almost anything.…
Q: What is the osmotic pressure of a 38 M glucose solution that intravenously injected to the blood at…
A: Glucose is a monosaccharide and it is a simple sugar that is the most important source of…
Q: QUESTION 21 Consider the following template strand of DNA: AAT TCA CCC 3' 5 The mRNA made from this…
A: DNA stands for Deoxy-ribonucleic acid. It is a molecule which carries the information of a proteins.…
Q: Which of the following is true of ribosome rescue? (C & E wrong) A. The process produces a protein…
A: Ribosomes are present in prokaryotes as well as eukaryotes. mammalian…
Q: ACTIVITY 8.2 Draw the different spontaneously formed lipid structures: a. Monolayers and bilayers b.…
A: The lipids are capable of organization into different types of structures in an aqueous environment…
Q: What is the principle of dialysis? A. Highly soluble contaminants will be removed as the…
A: The removal of contaminants from a protein sample is important in the purification of proteins.
Q: 1. One of the following is the simplest phosphoglyceride. a.Phosphatidylcholine b.Phosphatidic acid…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: Enumerate the 3 Coronavirus strains that caused a large-scale outbreak in humans in the past 2…
A: Coronaviruse is basically a group of RNA viruses that can causes the serious complication to birds…
Q: In normal mitochondria, which of the following is true for the rate of NADH consumption (oxidation)?…
A: Mitochondria occupy a significant part of the cytoplasmic extent of eukaryotic cells, and that they…
Q: Is taking Multivitamins plus zinc every day affect Our lipid metabolism? If yes, in what way?
A: Zinc, alone or in conjunction with some other recognised antioxidant minerals and vitamins, may…
Q: Trace the pathway of a protein from translation to the plasma membrane. You may name this protein…
A: Membrane proteins are a part of membrane structure, which are very important for a cell to carry out…
what are the effects of PSTMB shown and why is it important to show effects of PSTMB in vitro effects of PSTMB on LDHA?
https://www.nature.com/articles/s41598-019-40617-3
Step by step
Solved in 2 steps
- How was thermal stability measured in this paper and describe how GRL-1720 and 5h affect the thermal stability of Mpro and which drug has the larger effect? https://www.nature.com/articles/s41467-021-20900-6The Mechanism of Action of Cyclophosphamide and its toxicity reference :http://dx.doi.org/10.3390/scipharm88040042 (reseach paper DOI plz answer in detail do not give short answer )why is LDHA an attractive target for a cancer therapeutic? https://www.nature.com/articles/s41598-019-40617-3#Tab1
- What is the difference between steroidal and nonsteroidal aromatase inhibitors? which one is better for postmenopausal women and why? Explain in detail.The following data, presented by G. Bowes and W. L. Ogre in J. Biol. Chem. (1972) 247:2171–2176, describe the relative rates of incorporation of CO2 by Rubisco under N2 and under pure O2. Decide whether O2 is a competitive or uncompetitive inhibitor.A series of novel phenadoxone derivatives without mu2 receptor activity (mu2 activity is responsible for physical dependence) proposed to be developed as analgesics is shown below. Addition of which heterocyclic substituent R to phenadoxone is LIKELY to cause the MOST binding of the corresponding derivative to plasma proteins? Use the additivity of approximate estimates of logP to answer this question. phenadoxone derivatives A. Azetidine B. Thiophene C. Oxetane D. Furan E. Pyrrole ترف لي تي في R= -NH
- In 2-page worth of words (around 500), discuss CYCLAMATE's regulation, allowable levels, and what group of people are at high risk for the side effects of CYCLAMATE in the body.What is "tocilizumab"? Specify its nomenclature and explain its role in the treatment of COVID-19.What are the physiochemical properties of terazosin? With illustration