The following complex natural product has been biogenetically produced via a pericyclic reaction(s) at the final stage. Can you propose the structure of the precursor? Но H Me Me- OH H Me' Ме
Q: As you know Penicillin is produced biosynthetically from cysteine and valine. If the biosynthetic…
A: Introduction Penicillin analogs could be produced by the addition of appropriate precursors to…
Q: In Gillaspera, what is the general purpose of conversion of glucose to citrate besides of course the…
A: Introduction :- Mitochondria is the site of ATP production and site of cellular respiration…
Q: what is the key enzyme of the pentose phosphate pathway also serving as the dirst enzyme of the…
A: The initial metabolite of the pentose phosphate pathway is glucose-6-phosphate, 2 NADP+, and H2O.…
Q: Why do haloarchaea use the methylaspartate rather than the glyoxylate cycle for the incorporation of…
A: Haloarchea is the group of archaea that belong to the kingdom Euryarchaeota found in highly…
Q: The end products of tryptophan degradation are indole and pyruvicacid. Why do we test for the…
A: Indole test is a qualitative biochemical test conducted on bacterial species. It is used to detect…
Q: Question is mentioned in the attached file
A: In the bacteria, Salmonella typhimurium a series of mutations occurs that results in the requirement…
Q: relationship of the optimal pH and temperature on the absorbance value of enzyme…
A: The temperature increase or decrease with fixed pH, the absorbance decreases in enzyme activity…
Q: The turnover number of the enzyme fumarase that catalyzes the reaction,
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: The following is an intermediate formed during a FAS. The primer shown is condensed with 4 moles of…
A: Fatty acid synthesis takes place in the cytoplasm. The synthesis is catalyzed by an enzyme complex…
Q: The following is an intermediate formed during a FAS. The primer shown is condensed with 5 moles of…
A: The synthesis of fatty acid takes place in the cytoplasm by a multi-enzyme complex called fatty acid…
Q: What is the structure of the aldonic acid that is produced during the oxidation of l-rhamnose?
A: A sugar acid, also known as acidic sugar, is a monosaccharide that contains a carboxyl group at one…
Q: Seduheptulose is an intermediate in respiratory and photosynthetic pathways and plays a vital role…
A: a. The stable form of sugars like pentose and hexose sugars are five or six-atom rings and these…
Q: In nitrogen acquisition, what two metabolic pathways generate NH4+?Describe each one focusing on the…
A: The assimilation of ammonium into glutamate is the process where the element nitrogen is assimilated…
Q: How many cycles of β oxidation are necessary to completely catabolize palmitic acid ( CH3(CH2)14COOH…
A: Introduction: Fats are important sources of energy for our body as 1g of fat gives 9kcal of energy.…
Q: Consider the dextran sucrase reaction. Why do you suppose there is not an ATP requirement to…
A: Dextran sucrase is an enzyme that catalyses the chemical reaction.
Q: Biosynthesis of leucine involves conversion of 1-isopropylmalate to 2-isopropylmalate (see above).…
A: 2-isopropylmalate synthase is a enzyme which catalyzes below chemical reaction with three…
Q: Match each of the enzymes involved in de novo pyrimidine synthesis with the correct description:…
A:
Q: How many tritium atoms (3H) are incorporated into palmitate when fattyacid synthesis is carried out…
A: Palmitate synthesis requires the input of 8 acetyl CoA molecules, 14 NADPH molecules and 7 ATPs.…
Q: The rate constant for the uncatalyzed reaction of two molecules of glycine ethyl ester to form…
A: Given values: Rate constant in the uncatalyzed reaction = 0.6 M-1s-1 In the presence of catalyst…
Q: Which molecule does NOT require 5-phosphoribosyl-1-pyrophosphate (PRPP) as a substrate for…
A: The compound 5-phospho-de-rebosyl-α-1- diphosphate (PRPP) is an important biosynthesis of the purine…
Q: hlorophyll a molecules heme molecules Identify the Krebs cycle enzyme that consumes a six-carbon…
A: Citric acid cycle or Krebs Cycle is the cyclic metabolic pathway for the oxidation of various…
Q: The enzyme prenyl transferase is responsible for condensing isopentenyl pyrophosphate units during…
A: Prenyl transferases These are referred as class of enzymes that are involved in transfering allylic…
Q: What is the substrate that is not produced during the non-oxidative phase of the pentose phosphate…
A: Asked : The substrate not produced during the non-oxidative phase of the pentose phosphate pathway
Q: Name the three amino acids (AA) intermediate in the urea cycle. 2. What are the four…
A: Urea cycle is a series of biological reactions in which ammonia is converted into urea. Urea cycle…
Q: In the liver, gluconeogenesis can be used to convert the following compound(s) into glucose: Select…
A: Gluconeogenesis is observed to occur in the liver and kidneys. Gluconeogenesis provides the needs…
Q: The following is an intermediate formed during a FAS. The primer shown is condensed with 4 moles of…
A: Lipids are hydrophobic (water repelling) hydrocarbons (compounds made of hydrogen and carbon). Fats,…
Q: Which substrate is the best substrate for chymotrypsin? O N-acetylphenylalanine ethyl ester with Km…
A: Chymotrypsin is a digestive enzyme component of pancreatic juice acting in the duodenum where it…
Q: The following is an intermediate formed during a FAS. The primer shown is condensed with 4 moles of…
A: The fatty acid is a long chain of hydrocarbon with the presence of carboxyl group as the functional…
Q: What is unique about methanotrophy in Methylomirabilis oxyfera?
A: Methane and several other C1 organic compounds can be catabolized by both in the presence of oxygen…
Q: The nitrogenase complex can reduce molecules other than N2. Provide the structures for the products…
A: Nitrogenases are the enzymes that are produced by some bacteria like cyanobacteria and are…
Q: What is the quaternary structure of glycogen phosphorylase? How would you characterize the…
A: The allosteric effect is generally the binding of a ligand to one part on a protein molecule and…
Q: How many high-energy phosphate bonds must be hydrolyzed in the pathway that produces GMP from…
A: High-energy phosphate bonds are pyrophosphate bonds, acid anhydride linkages formed by taking…
Q: Explain the chemical mechanism yeast alcohol dehydrogenase undergoes?
A: Yeast alcohol dehydrogenase is the enzyme that reduces acetaldehyde to ethanol during the…
Q: List the following substances in order of increasing tendency to accept e-: a. pyruvate, b. CoQ,…
A: E0 : Standard reduction potential More positive E0 : greater tendency to accept electrons
Q: What are the structural elements that are required for proper function in yeast alcohol…
A: During fermentation of glucose yeast alcohol dehydrogenase reduces acetaldehyde to ethanol. Glucose…
Q: For production of penicillin (C16H18O4N2S) using Penicillium mold, glucose (C6H12O6) is used as a…
A: Introduction :- The penicillin is an important antibiotic produced by the microorganism which helps…
Q: Identify the substrate, enzyme, and products in the following chemical reaction: HO но. HO HO HO но…
A: The reaction that is depicted above is ONPG test that is used to assess the capability of micro…
Q: What reaction does synthine aminotransferase catalyze? what are the precursors and products? why is…
A: Enzymes are proteins that go about as natural impetuses. Impetuses speed up compound responses. The…
Q: what is the enzymes to produce the following intermediate: enolpyruvyl shikimate-3-phospate EPSP…
A: The shikimate pathway is a seven-step metabolic pathway that combines the metabolism of…
Q: The following is an intermediate formed during a FAS. The primer shown is condensed with 4 moles of…
A: Fatty acid synthesis occurs in the cytosol. Before the fatty acid synthesis, acetyl CoA is…
Q: If a biochemist is trying to synthesis a 14C Valine at the a-Carbon using Pyruvate as a starting…
A: Pyruvate is a byproduct of glycolysis and L-valine is non-polar amino acids with side chain group of…
Q: Saccharomyces cerevisiae is used in the production of wine and beer, while Lactobacillus acidophilus…
A: Introduction :- Saccharomyces cerevisiae is an eukaryotic organism which is used in the production…
Q: The primary route of carbon entry into the tetrahydrofolate (THF) pool is via the serine…
A: Purine is a two-ring heterocyclic aromatic chemical. It's a substance that can be dissolved in…
Q: All of the following is correct about folate and vitamin B12 involvement in resynthesis of…
A: Vit B12 and folate have a very important role in many different physiological functions. Vit B12 and…
Q: For production of penicillin (C16H18O4N2S) using Penicillium mold, glucose (C6H1206) is used as a…
A: The penicillin is an important antibiotic produced by the microorganism which helps in inhibiting…
Step by step
Solved in 2 steps with 1 images
- A 65-year-old man with severe atherosclerotic coronary artery disease comes to the emergency department because of a 12-hour history of chest pain. Plasma activity of the MB isozyme of creatine kinase (MB-CK) is markedly increased. Which of the following processes is the most likely explanation for the increased plasma MB-CK? (A) Cell membrane damage (B) Endoplasmic reticulum dilation (C) Mitochondrial swelling (D) Polysome dissociation (E) Sodium pump dysfunctionIdentify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I first attempted this question I identified the open reading frame as starting from ATG. However I was told that my reading frame was wrong and that the frame should include an asparagine group but how it that possible?TPCK and TLCK are irreversible inhibitors of serine proteases. One ofthese inhibits trypsin and the other chymotrypsin. Which is which? Explainyour reasoning. Suggest the effects of each of the following mutations on the physiologicalrole of chymotrypsinogen:(a) R15S(b) C1S(c) T147S
- Congenital sucrase-isomaltase deficiency (CSID) is a genetic condition that prevents the metabolism of cane sugar (sucrose). This condition can result in, among other things, abdominal cramps and bloating, diarrhea, vomiting, and increased susceptibility to upper respiratory tract infections. A) Suggest a possible molecular mechanism underlying this condition. B) Based on the mechanism described above, offer a hypothesis as to why this condition may be more severe in some individuals than others.We learned that three different amino acid transformations of PLP-dependent enzymes canresult from different conformations of the PLP-amino acid imine adduct in the active site.Starting from the PLP adduct of (S)-serine, show mechanisms fora) Decarboxylation of serineb) Racemization of serinec) Conversion of serine to glycine and formaldehyde.A Leu →Ala mutation at a site buried in the core of the enzyme lysozymeis found to be destabilizing. Explain the observed effect of this mutationon lysozyme stability by predicting how enthalpy (ΔH°), conformationalentropy (ΔS°peptide), and the hydrophobic effect (ΔS°solvent) are expected to change for the mutant compared to wild-type lysozyme. Explain how ΔG°for unfolding is affected by your predicted changes in enthalpy or entropy.
- O- linked glycosylation of acceptor serine and threonine residues takes place in the golgi. true false4. Cells sense internal amino acid levels to couple their metabolic state with their gene expres- sion programs. One key regulatory switch that amino acid levels control is expression of the genes required for ribosome biogenesis – all the proteins and RNA molecules that required to generate the small and large ribosomal subunits. Ribosome biogenesis is one of the most resource-intensive pro- cesses in proliferating cells. In order to couple ri- bosome biogenesis – which entails high level syn- thesis of hundreds of proteins – with the availabil- ity of amino acid precursors required to make those proteins, cells evolved a signaling network that converges on a key protein complex in the cell known as MTOR complex 1 (MTORC1). The net result of the signaling network shown in the diagram is that mTORC1 is ultimately activated by the presence of leucine and arginine in the cell (the blunt arrows represent inhibitory interactions; the details are not important here). When MTORC1 is active,…>MK585652.1 Sardinella tawilis voucher TaSt3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial GGTGCTTGAGCAGGGATAGTAGGGACTGCCCTAAGTCTCCTAATTCGGGCGGAGCTAAGCCAGCCCG TTTCTTCATAGTGATGCCAATTCTAATTGGGGGTTTTGGGAACTGGCTCGTCCCTCTAATGATCGGGGC TTCTCCTAGCCTCTTCGGGCGTAGAGGC GGGCAGGGACGGGTTGAACAGTATACCCGCCCTTGGO ATCTCGTCAATTCTTGGGGCGAT ACCACAATTATTAATATGAAACCCCCTGCAATT CAGTCCTGGCTGCCGGGATCACTATGCTATTAACAGATCGAAACTTAAATACAACTTTCTTCGACCCTGCAGGAGGAGGAGACCCAATTCTATACCAACACCT The highlighted text refers to the Gene origin Gene identity Accession number O Species identity GGACGACCAGATTTACAACGTCATCGTCACGGCACATGCCTTCGTAATGAT TCCCGCGAATAAACAACATGAGCTTCTGGCTCCTTCCCCCTTCCTTCCTTC of the sequence? SGGGCCTCTGTCGACCTTACCATCTTCTCACTCCACCTAGCAGGT TTGAGCTGTTCTCGTAACCGCTGTGCTTCTCCTTCTCTCCCTTC
- Orotic aciduria is a rare hereditary disorder due to deficient orotate phosphoribosyltransferase and orotidine-5'-decarboxylase activities that are encoded by Uridylate (UMP) synthetase gene in de novo pyrimidine biosynthesis. The characteristic of this disorder is excessive excretion of orotic acid in urine. A mutation of UMP synthetase gene has been identified as R96G (at amino acid position 96, Arginine is changed to Glycine). In orotic aciduria, predict the consequences of deficient UMP synthetase by identifying which downstream enzyme missing its action. One of important molecules to be derived from pyrimidine biosynthesis is deoxycytidine triphosphate (dCTP) for DNA replication and repair. How is dCTP synthesized, include what enzymes and important intermediates in the pathway? 3. As thymidine triphosphate (dTTP) is needed for DNA replication and repair, what enzymes and intermediates are required to get dTTPWhy is the position of Cys 58 important in 3GRS(GLUTATHIONE REDUCTASE)? When Cys 58 is mutated to GLY 58 how would it impact the 3D structure and function of 3GRS? explain in terms of how Cys and GLY have different properties and how it would impact the function of 3GRS (the binding sites etc.) You can see your structure(3GRS ) here or any other website: https://www.rcsb.orgWould the following alterations to Src be oncogenic? Explain. (a) The mutation of Tyr 527 to Phe. (b) The replacement of Src residues 249 to 253 with the sequence APTMP.