Research have stated that there are factors that could affect the efficacy and duration of mosquito repellants on our skins. State at least 3 factors that could decrease or influence the efficacies of topical mosquito repellants.
Q: in your own words, describe the squash soup in terms of appearance, color, size, shape, texture (fi...
A: Squash soup is made from a wide varieties of squash which provides it a appetizing flavor. Along wit...
Q: Marfan Syndrome is a dominant trait inheritance in humans. It is a disorder that affects the connect...
A: ANSWER: Let us consider, M is the dominant gene and m is the recessive one. As marfan syndrome is th...
Q: How does natural selection lead to the formation of new species?
A: *Natural selection is a process of evolution. *Organisms adapted to their environment are likely to ...
Q: Label the tissues that form each layer, namely the columnar epithelium, reticular fibers, smooth mus...
A: In this photomicrograph i can't labelled the reticular fibre and loose CTP because of this image not...
Q: A broth culture is initially inoculated with a single bacterial cell. For the first hour the bacteri...
A: * Given that The bacteria has generation time of 30 minutes. So it takes about thirty minutes to di...
Q: Which is NOT a component of a Gram-positive bacterium's cell envelope? ○ peptidoglycan ○ N-acetylm...
A: Bacteria are classified according to their nature of cell wall into Gram positive and Gram negative ...
Q: . Why are protist, plants, fungi and animals classified into the same domain but into different king...
A: Introduction :- Fungi, in collaboration with bacteria, break down organic matter and release carbon,...
Q: On a fox ranch in Wisconsin, a mutation arose that gavea “platinum” coat color. The platinum color p...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: What is myocardial infarction (a heart attack)?
A: Introduction In this question we have to discuss about the infarction ( a heart attack).
Q: Unpacking Problem 411. What type of organism is E. coli?2. What does a culture of E. coli look like?...
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...
Q: Why do plants need to exchange gases with the environment?
A: Introduction In this question we will discuss about why plants need to exchange gases with environm...
Q: In a maternity ward, four babies become accidentallymixed up. The ABO types of the four babies are k...
A: Blood group is determined or governed by three alleles (as opposed to normally two alleles) in human...
Q: Describe the hair and give the components
A: Hair Thin elongated keratinized structures present over almost all of the body surface hair is forme...
Q: 1. Explain what "optimum" means. Do all enzymes have the same optimum pH and temperature?
A: Optimum means a state at which the best of a reaction or outcome occurs.And it is a level at which t...
Q: 1- Determine the classification for the following devices (CE and FDA): A- Single use scalpel B- A d...
A: Introduction:- Medical devices are assigned to one of three regulatory classes based on the level of...
Q: 1-true tissues or not- who does not have? 2- radiate/bilateria- who for sure is in radiate? 3- diplo...
A: Kingdom Animalia / metazoa The kingdom Animalia is classified into Two Sub Kingdoms , they are - P...
Q: In Figure 5-15, how are each of the following genotypesproduced?a. F+ a− c. F− a+b. F− a− d. F+ a+
A: Recombination is a technique by which pieces of DNA are broken and recombined to produce new combina...
Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...
A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...
Q: Compared to a 3% agarose gel, how far should the same size DNA travel in a 1% agarose gel? not as fa...
A: The DNA has a uniform mass proportion, DNA particles are isolated by size inside an agarose gel in a...
Q: Meiosis produces daughter cells that are ; while mitosis produces daughter cells that are O Similar ...
A: Meiosis produces daughter cells that are very different from each other and from the parent cell ; w...
Q: Cotegory: Inflammation Mechanism of vascular permeability includes all of the following EXCEPT:
A: Endothelial contraction renders spaces between adjacent endothelial cells and hence increases permea...
Q: comprise the membrane. If you isolated a single transmembrane helix from a protein from this strain,...
A: Since the newly identified bacteria has normal nucleic acids and proteins - the amino acids in the p...
Q: In Figure 6-21, propose a specific genetic explanationfor individual Q (give a possible genotype, de...
A: Examples of diseases showing an incomplete penetrance are Huntington's disease and breast cancer. Bo...
Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...
A: DNA is a basic hereditary molecule that carries information related to the person.
Q: Patricia is loudly playing very low notes on the tuba to annoy her brother. What part of her basilar...
A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the h...
Q: How does crossing over shuffle alleles?
A: The meiosis is a cell division process that involves division of a diploid (2n) mother cell and prod...
Q: What is the phenomenon of apical dominance in plants? How can it be artificially eliminated?
A: Introduction In this question we have to discuss about the phenomenon of apical dominance in plant a...
Q: a. Explain your understanding of the renal system
A: The excretory system is a system that is found in the human body. This system's job is to eliminate ...
Q: Identify the steps involved in designing an experiment.
A: Experiments are conducted to test a particular hypothesis. Results then give a measure of how true o...
Q: Complete the process of the blood flow through the heart by filling in the missing terms in the diag...
A: The heart is responsible for transporting blood throughout the body. The arteries are responsible fo...
Q: Based on the information above, what can you speculate about the possible evolution of the genes tha...
A: Rab proteins are small GTP-binding proteins within a superfamily of GTPases known as the Ras superfa...
Q: In humans, PKU (phenylketonuria) is a recessive disease caused by an enzyme inefficiency at step A i...
A: A recessive disease requires two copies of the abnormal allele to manifest, that is, individuals sho...
Q: 3. What would be the optimum pH for pepsin, an enzyme that breaks down protein in your stomach? Why?
A: ANSWER) The optimum pH for enzyme Pepsin is 2. At 2 pH Pepsin exhibits maximal activity.
Q: Suppose you had to design a hypothetical drug for Alzheimer's disease. Which of the following best d...
A: ANSWER;- C.) A drug that increases the level of APP protein in the neuron. It is a very effective ...
Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...
A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC
Q: How would we amplify the target DNA associated with PTC tasting? O We use restriction enzymes to amp...
A: PCR polymerase chain reaction, is the most useful invitro techniques nowadays to amplify double stra...
Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...
A: Genes are the basic units of inheritance in living organisms. They are passed down from parents to t...
Q: tabulate similiraties and differences of mitosis and meiosis
A: Introduction:- Mitosis and meiosis are the two ways that cells divide and reproduce. Meiosis produce...
Q: What is the climax stage of an ecological succession?
A: Introduction In this question we will discuss about the climax stage of an ecological succession.
Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...
A: Introduction :- Escherichia coli (E. coli) is a type of bacteria that can be found in the environmen...
Q: Why are EMBRYOS so useful when comparing phylogenic relationships?
A: The majority of these similarities occur during embryonic development. Pharyngeal slits, which devel...
Q: What difference of person to have Muscular body compare to very muscular and extremely? Like three d...
A: The muscular system is in charge of the human body's mobility. Around 700 identified muscles are att...
Q: Suppose that you are asked to write a new class for DNA. What are the main attributes and functions ...
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and...
Q: NAD+ b. Pyruvate
A: Fermentation is a well stated to been supposed to define as is a metabolic process that involves the...
Q: Provide two examples using the term “sex” and two examples using the term “gender”
A: The terms sex and gender are generally considered to be interchangeable; however, they can be differ...
Q: Melting of _____ does not contribute to sea level rise a. Greeland ice sheet b. Antarctic ic...
A: Melting of ice leads to the increase in sea level. When the temperature increases, polar caps melt. ...
Q: What is an aliquot? Give two uses of serial dilution.
A: Introduction: Serial dilution is a series of repeated dilution performed on the same solution to cha...
Q: 2. In horses, black coat color is influenced by the dominant allele (B) and chestnut coat color is i...
A: The recessive characteristic will only be displayed in offspring with two copies of the recessive ge...
Hello, good day. I have a problem answering this question, and I need your help. Hoping for a response, and thank you so much.
Instruction: The answer must be in a minimum of 2 paragraphs, and each paragraph must have a minimum of 4 sentences.
Question: Research have stated that there are factors that could affect the efficacy and duration of mosquito repellants on our skins. State at least 3 factors that could decrease or influence the efficacies of topical mosquito repellants.
Step by step
Solved in 2 steps
- Write about Pfizer-BioNTech COVID-19 vaccine (Tozinameran) You must include the following information Chemistry of the drugs: Structure, physicochemical properties, (log P, pKa, & stereochemistry) and chemical properties and stability. Mechanism of action: (including the possible drug target interactions) in CoVid-19 Pharmacokinetic: Absorption, distribution (% plasma binding), chemical basis of metabolic pathways and elimination Pharmacological properties including side effect, ADR, drug interaction, precautions, dose and dosage forms Stability and storage conditions, as well as Brand namesNursing question. It is all right to forward chain letters via office e-mail as long as it is dong quickly. True or false.CHOICES: Isoniazid Rifampicin Ethambutol None of the Choices Causes more adverse effects to slow acetylators Causes optic neuritis Causes orange secretions Inhibits transcription process in mycobacteria Binds to bacterial DNA gyrase & topoisomerase
- Hello good day, I am having a problem answering this question and I need your help on this. Hoping for a response and thank you In each chosen disease, pls. supply the information below: So I've chosen "Phenylketonuria (PKU)", so I need a short description, its pathophysiology, laboratory diagnosis, and Treatment and Prevention of my chosen disease. a. Short Description b. Pathophysiology c. Laboratory Diagnosis d. Treatment and Prevention#3.Answer needed quickly reponse.. After discussing his case with his physician, he learned that he had probably been the victim of pufferfish poisoning. The active toxin in the tissues of this fish is a chemical called tetrodotoxin (TTX). Tetrodotoxin is in a class of chemicals known as neurotoxins because it exerts its effects on neurons. The specific action of tetrodotoxin is that it blocks voltage-gated sodium ion channels. Define the following phrases and terms associated with the signs and symptoms of Dr. Westwood’s TTX poisoning: diaphoresis motor dysfunction paresthesias cyanotic hypoventilating bradycardia gastric lavage oxygen saturation As mentioned in the case description, tetrodotoxin is a molecule that blocks voltage-gated sodium ion channels. What is a voltage-gated sodium ion channel and what is its function?.Please answer it carefully. Thank you. Click the link below and read the article. Answer the guided questions. https://www.fs.fed.us/wildflowers/ethnobotany/resins.shtml Guided Questions:1. Based on your knowledge about gums and mucilages, how will you differentiate resins from them? (One sentence only)2. From all of the drug classifications that you learned so far, which one strikes you the most and made you realize its potential in developing new drugs? Give one (1) reason.
- In own words. Write short note or summary on the given topics: 1. Automatic capsule filling machine?Indicate whether each statement is true or false, and justify your answer.Phase III clinical trials are a minor part of the drug development process in the US.Answer all Correctly completely please with full n nice explanation What is the name of this drug ?and can we take it orally or not, in other words is it available for an oral dose? OH NH2 Он N- HO HOOC CH3 H2N N'