Q: Coronavirus background and origin
A: Background of coronavirus. COVID-19 is caused by a virus called SARS-CoV-2. It is a member of the…
Q: Which of the following terms describes bacteriophage DNA that has become integrated into the host…
A: Microorganisms are the tiny entities that cannot be seen as such through naked eyes. They require…
Q: Again, at the making of this exam, the following numbers represent people that have been infected…
A: Number of infected people in California- 819,782 people Oregon - 33,862 people Washington- 87,522…
Q: Below is an image of the results of a gel electrophoresis experiment. Lanes 1-4 contain amplified…
A: In gel elctrophoresis, smallest DNA fragment travels the farthest. (A) From the diagram, we can see…
Q: Analysis of a mRNA sample showed that 18% of the nitrogen-base molecules present were uracil…
A: due to time constraints we will be answering your first question here, please ask the second…
Q: Which of the following statements is false about the impacts of climate change? Choose all that…
A: Climate change is having a wide range of impacts on the environment, including increased…
Q: Punnett Square Worksheet Select 5 of the 6 scenarios to complete this activity. You will only be…
A: Square Punnett 1.This square-shaped graphic is used to predict genotypes in breeding or cross…
Q: Discuss how the use of antimicrobial agents selects for resistant microbes and explain how…
A: Antibiotic and antifungal use puts pressure on bacteria and fungi to adapt, which speeds up the…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: D Question 12 Anaphase involves the: Re-forming the nuclear envelope de-compaction of chromosomes,…
A: Answer and explanation - Anaphase -segregation of sister chromatid. Other charaters- chromatid move…
Q: How does position effect influence gene expression? TI The movement y! CDC The movement of the…
A: ANSWER : The correct option is: All of the above answers are correct
Q: Site of transcription Choose a match
A: All of the given matches are correct but Transcription takes place in the nucleus. An RNA…
Q: The etiologic fraction refers to which of the following? Group of answer choices C. Fraction of…
A: The greatest estimate of the percentage of disease incidence that would be avoided if a particular…
Q: 2.- Draw a step by step diagram of the translation process then explain what is happening in each…
A:
Q: Question 16 What is a common misconception about diabetes? O You can lose a limb Diabetes stems from…
A: Diabetes mellitus is a disorder of carbohydrate metabolism characterised by impaired production or…
Q: Protein structure is central to our understanding biological systems. The tubular proteins that make…
A: Primary, secondary, tertiary, and quaternary structures are the four levels of complexity that can…
Q: Why should we take caution when public discussions promoting efforts that would result in reducing…
A: Modern human variation is the result of a combination of genetic, environmental, and cultural…
Q: 1) Compare and contrast population ecology, community ecology, and ecosystem ecology
A: Ecology derives from the Greek terms for "HOUSE" and "DISCUSSION/SPEECH," OIKOS LOGOS. The planet is…
Q: What are the processes in order for a biomass become a useful.source of energy. Outline/ illustrate…
A: Biomass the amount of organic matter present in the plants or animals. This biomass can be utilized…
Q: Chemicals will interact with different odorant receptors based on different... sizes of chemicals…
A: Introduction Olfactory receptors are also or odorant receptors. They are responsible for the smell.…
Q: What are the specific roles of growth factors in a bacterium.
A: Growth factors are molecules naturally present in the body that stimulate cellular growth,…
Q: Which of the following hypothetical islands would likely have the greatest species richness?
A: Biodiversity, often known as biological diversity, refers to the variety of life that can be found…
Q: Prompts Site of Photosynthesis site of Cellular Respiration Site of transcription Site of…
A: Cell is the smallest living unit of life. All living cells perform basic characteristics like…
Q: Select the sequences relevant to eukaryotic translation AGGAGG (Shine-Dalgarno sequence) AUG start…
A: The eukaryotic translation is the process by which mRNA molecules are translated into proteins in…
Q: About 70 percent of all Caucasians can taste the chemical phenylthiocarbamide, and the remainder…
A: There is present single gene in the population. These are T and t. TT and Tt encode taster…
Q: What would a dichotomous key for enterobacter look like?
A: E. aerogenes is a small, solitary rod that is found mostly in soil, water, and dairy products and…
Q: Do you think it's ethically allowed to use genetics to fix a heart disease? Why and why not. Your…
A: Ethical issues related to the use of genetic technologies include potential privacy breaches,…
Q: Can we just insert a gene on an organism? - In plants, the use of Agrobacterium, we're there any…
A: Transfer of genes is a common component of genetic engineering projects, i. e. DNA transfer between…
Q: 21. Of the following which act as keystone species: A. Starfish B. Reef building coral C. Long leaf…
A: Keystone species are the first inhabitants of a particular ecosystem. They are important for other…
Q: Which of the following statements about carcinomas, which are tumors derived from epithelial cells,…
A: Normally, epithelial cells are a kind of cell which are found on the exterior surface of our skin as…
Q: Based on the haplotype network below, which statement is correct? a. None of the answers is correct…
A: A sort of genetic difference within humans can be called single nucleotide polymorphisms or SNPs.…
Q: There are various types of connective tissue. Explain how differences in this tissue type aid in…
A: Connective tissue is found in between other tissues and is present everywhere in the body, including…
Q: The human body has structures that could be considered the product of “unintelligent design” (i.e.…
A: Organisms are never perfectly designed or adapted. In reality, "perfection" cannot be found in…
Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice. Q1:…
A: The size of the island and its position is very much crucial for species richness. There are several…
Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 54). Please answer both…
A: In a biological community, there are a variety of colonies of different species coexisting in close…
Q: Next, it's important to understand how the gene would be transcribed and translated. 1 agagtctcct…
A: i. Coding region of this gene is 288 nucleotide long. ii. We all know that exons are the coding…
Q: Best Amyloidosis special stain in sunny areas? a. Congo Red O b. Pagoda Red O c. Crystal Violet d.…
A: Staining is a technique by which microorganisms and cells are stained by dye so they can visible in…
Q: QUESTION 5 Which of the following cells are not found in the intestinal crypts of the small…
A: The crypts of Lieberkuhn are the tubular glands that lie between the finger-like projections of the…
Q: 7 In what regions of the world have Neanderthal bones been found? List at least one site in each…
A: Introduction The origin of life on earth can be traced back to 3.4 billion years ago, as we now…
Q: How do you feel about the fact that you (the general public), as of today, can purchase biohacking…
A: CRISPR kits are gene-editing kits that enable users to experiment with the CRISPR/Cas9 gene editing…
Q: 4. Compare and contrast ESCs and iPSCS by considering the following: A) Describe the method of…
A: Over the last few years, biomedical engineering has grown in popularity. Biomedical engineers' new…
Q: thank you and hava a nice day :) Article: Can Nanotechnology Help to Control the Cytokine Storm?…
A: This article is about covid-19 pandemic and how it is responsible for killing so many people. The…
Q: 4.08 ¡Î1.02↑ E E 2.54 H H 1.02 Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H =…
A: An RNA transcript or the DNA encoding its introns are non-coding segments that are spliced off…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…
A: Annotating a genome involves finding functional components throughout its sequence in order to give…
Q: You are evaluating a trait that is associated with fur color in mice. The trait is controlled by a…
A: Here the genotype of the mother is A1A1 and the genotype of the father is A2A2 By Crossing we get…
Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C GTA GA ATT is Using this strand of DNA as a template,…
A: The basis of inheritance is the information passed down from parent to offspring. The replication of…
Q: How is it not The anterior cerebral artery?
A: Anterior cerebral artery is The anterior cerebral artery (ACA) is one of two cerebral arteries( the…
Q: T-helper cells release signal molecules called immune response cytokines, nonspecific (or innate)…
A: Helper T cells or Th cells coordinate immune responses by communicating with other cells. In…
Q: Distance en left her house and drove to college in the morning, as shown in the ccompanying graph.…
A:
Q: 2. Restriction Enzyme Mapping - use any resources to assist you including the hints below. A…
A: Focus only on EcoR1. Than focus on EcoR1 and HindIII. Than focus on EcoR1, HindIII and Pst1
Define natural selection using the 5 points below to explain its role in understanding primate behavior.
(1) there is variation among individuals;
(2) some of that variation is heritable;
(3) there is always competition between individuals for
(4) some variants outcompete other variants and leave more offspring;
(5) to the extent that the parent's traits are heritable, then a larger portion of the next generation will reflect those traits.
Step by step
Solved in 2 steps
- Humans often survive beyond their childbearing years, which is unique among primates. The grandmother hypothesis states that human longevity beyond childbearing years is selected for because grandmothers benefit the children of their offspring. This effectively increases survivorship of the offspring of their offspring (two generations into the future). Assuming that human longevity also has a cost, e.g. reduced fecundity (number of offspring), which of the following would most likely produce selection for longer lives? (Not required, but if you are interested see this popular press story about the "evolution" of this hypothesis: http://www.theatlantic.com/health/archive/2012/10/the-evolutionary-importance-of- grandmothers/264039/ 2 ) Selection only occurs if females, and not males, have extended lives, that is why males have a shorter life expectancy O Human grandmothers must only nurture their own children and not their grandchildren O Increased survival in grandchildren due to…Natural selection and artificial selection or selective breeding can both cause changes in animals and plants. The difference between the two is that natural selection happens naturally, but selective breeding only occurs when humans intervene. Changes in genetic traits have occurred over generations through both natural selection and selective breeding although the occur through different means. What characterizes only artificial selection? Choose all that apply. A) chickens that lay larger eggs are favored B) selection increases the chances of surviving C) selection make a species stronger and fit for survival D) selection favors the desired characters in the new organismsJean-Baptiste Lamarck (1744-1829), a French scientist who believed in evolution, is known for Lamarckism, or inheritance through acquired characteristics. He argued that environmental influences could put pressure on animals, making them use some characteristics more and some less, and that the changes acquired by the parents would be passed to the next generations. A common example of this theory is that giraffes could actually grow longer necks by straining to get to higher and higher branches for food, and that the offspring of these longer- necked giraffes would have longer necks at birth. We will get to epigenetics later in the class, and realize that Lamarck wasn't all wrong. But he was mistaken about giraffes! Your responses will help you understand why... (France page 7) a. Is this argument at the level of a hypothesis, or is it a theory? Why? b. How would you set up an experiment to test Lamarck's beliefs? c. What would be your dependent variable? d. What would be your…
- According to Darwinian evolution, there must be variation and selection. In the evolution of large claws in lobsters: What trait(s) might have been variable? What factors might have resulted in members of the population being selected? Speculate about why predatory cats such as the lion and the leopard have not evolved to be as fast as the cheetah. The elephant has evolved to be a great size, while the mouse has evolved to be relatively small. Explain how natural selection might favour a different size in each mammal species.When discussing natural selection and behaviour, we often say that members of a species have certain behavioural traits because those traits are adaptive, in the sense that they increase inclusive fitness relative to alternative forms of those traits that have existed in the past. Instead of emphasizing the adaptiveness of behavioural traits, some biologists describe natural selection as a process that operates on nervous system traits, increasing the prevalence within a population of particular patterns of neural circuitry and neurobiological mechanisms. As an alternative to emphasizing either the behaviour or the nervous system, some biologists describe natural selection as a process that operates on genes; according to this perspective, certain forms of certain genes (ie., particular alleles) increase in prevalence within a population relative to alternative forms of those genes. Which, if any, of these three perspectives on natural selection and behaviour do you think is the most…|(A) Briefly explain the Darwinian theory of natural selection. (B) Darwin also developed the idea of sexual selection. Explain sexual selection. (C) How might sexual selection lead to exaggerated morphology or behavior? (D) and how might natural selection affect the evolution of these exaggerated traits?
- Nursing bees take care of the queen and newly hatched bees. However, nursing bees themselves do not reproduce. How could natural selection act upon such behavior? Because this behavior does not directly benefit the nursing bee itself, it is not favored by natural selection. Because this behavior increases the number of surviving offspring that share genes with the nursing bee, it is favored by natural selection. Because this behavior selectively decreases the number of offspring harboring non-similar genes with the nursing bee, it is favored by natural selection. Because this behavior does not increase the number of surviving offspring that are identical in genes with the nursing bee, it is not favored by natural selection.This spectacular animal is a Lesser Bird of Paradise, Paradisea minor, from the highlands of Papua New Guinea. In the context of various evolutionary phenomena, why do you suppose: (a) This bird is confined to New Guinea and two nearby islands? Why would you not expect to find it in the mountains of Borneo? Explain in detail. (b) This spectacular tail presumably attracts predators; why hasn't natural selection acted to reduce it or camouflage it? Explain in detail.Describe how changes in the ladybugs'environment may influence their survival and/or reproduction. Make sure to use the vocabulary terms adaptation, natural selection, and polymorphic.
- Give a Darwinian explanation of how cheetahs evolved to become faster. Your explanation is how natural selection works using Cheetahs as an example. Be sure to include andexplain the ideas of differential reproductive success and descent with modification. (You do not need to mention the formation of new species.)Answer the following: This spectacular animal is a Lesser Bird of Paradise, Paradisea minor, from the highlands of Papua New Guinea. In the context of various evolutionary phenomena, why do you suppose: (a) This bird is confined to New Guinea and two nearby islands? Why would you not expect to find it in the mountains of Borneo? Explain in detail. (b) This spectacular tail presumably attracts predators; why hasn't natural selection acted to reduce it or camouflage it? Explain in detail.Bjork and Pitnick (2006) investigated sexual selection in Drosophila melanogaster. Which of the following is an accurate conclusion that can be made from their results below? [Note that the open circles and dotted line represent data collected from females and the closed circles and solid line represents data collected from males.] 200 - 150 100 50 1 2 4 5 Number of mates (mating success) O a. Sexual selection is stronger on females than males. O b. Males have a weaker Bateman gradient than females. O C. Females likely invest more in the reproductive process. O d. Males likely exhibit parental rather than females. Number of offspring (reproductive success)