In order to do electron microscopy the samples had to be specially prepared. Were the cells alive at the time of viewing? Explain why you said yes or no
Q: Identify the genotypes
A: Autosomal dominant - Characteristics of autosomal dominant inheritance: 1. A gene is dominant if it…
Q: 9% of individuals within a population of butterflies are resistant to milkweed toxins, a trait which…
A: Introduction : Hardy Weinberg principle is based on certain assumptions. These are as listed as…
Q: Which of the following is NOT true of deoxyribonucleic acid (DNA)? Stores genetic information that…
A: Introduction : The organic components known as nucleic acids can be found in the form of DNA or RNA…
Q: Based upon the attached image and your answer above, what is the genotype of the unknown individual?…
A: Trait is a characteristic feature that is unique to particular individual. Each trait is represented…
Q: 3. A person severely allergic to bee stings gets stung by a bee. A) The person begins to experience…
A: INTRODUCTION : Anaphylaxis : Is is a very severe allergic reaction which is due to the body's immune…
Q: Which of the following is associated with only the lagging strand during DNA replication? a. RNA…
A: DNA is double stranded which is translated into RNA which then transcribed to form proteins.
Q: attempt to evolve cold-tolerant winter
A:
Q: 13. Integral membrane proteins contain: о Only hydrophobic regions Both hydrophobic and hydrophilic…
A: Since you have posted multiple questions, we will provide the solution only to one specified…
Q: mechanics of breathing
A: Breathing: It is defined as the process where atmospheric O2 is exchanged with CO2 which is…
Q: What are bioreactors? How are large volumes of cultures maintained and processed in them?
A: Recombinant DNA technology is a method in which genetic material is altered so as to form desired…
Q: 1. What are the possible sources of error in the measurement of CK and LDH activity?
A: Lactate Dehydrogenase (LDH/LD): Specimen CollectionSources of Error- Hemolysis• RBCs contain 100-150…
Q: Why test that mice infected with B. anthracis produce antibodies to the S-layer proteins? What is…
A: B.anthracis is a rod shaped, Gram positive bacteria which causes anthrax disease. It contains some…
Q: Outline the pathogenesis of Myasthenia gravis and the consequential effects from the disruption at…
A: A severe autoimmune, nerve and muscle condition known as myasthenia gravis results in weakness in…
Q: 5. Which of the following is considered acellular? Aspergillus fumigatus Mycobacterium tuberculosis…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which type of stimuli is represented by a stressor such as a pop quiz or a knock on the door in the…
A: A stress reaction is triggered by any mental or physical stimulus that throw off equilibrium. Stress…
Q: A bacteria culture starts with 140 bacteria and grows at a rate proportional to its size. After 5…
A: Given that the starting population of bacteria is 140 and it grows at a rate proportional to its…
Q: Exaplain the two methods to study the contents of transcriptomes which are microarray analysis and…
A: Transcriptome analysis may be used to find novel genes and isoforms that are not already cataloged…
Q: the signs and symptoms of meningitis, and identify several risk factors. Describe a clinical test…
A: The infection and inflammation of the fluid and membranes surrounding the brain and spinal cord are…
Q: 8. Which of the following is the complementary base pairing of the DNA sequence 5' ATTCGGCTTA 3'? a.…
A: DNA replication is the process by which cells create an exact copy of their genetic material before…
Q: An individual expressing the dominant phenotypes for kernel color and texture could have one of four…
A: It is a dihybrid cross, with dominant phenotypes for kernel color and texture having one of four…
Q: A. Eukaryotic Cells We first will examine cells of Elodea, a eukaryote. With forceps, obtain a leaf…
A: Leaf cells can be examined using a variety of microscope techniques, including light and electron…
Q: as a future nurse, how will you promote the health of an individual, family, population, and…
A: As a healthcare professional, nurses play a critical role in promoting the health and well-being of…
Q: Simulate mitosis and meiosis. For simplicity, assume the cell has two homologous chromosomal pairs…
A: Mitosis: Mitosis is the process where the mother cell divides and produces two new cells called the…
Q: 52. Which of the following describes the benefits of free-range grazing for meat production?…
A: Free-range grazing is a method of raising livestock in which the animals are not confined to a…
Q: 5. Which function is controlled by the somatic division of the PNS? voluntary muscle movements blood…
A: The science of humankind via the effects and interactions of many different academic disciplines,…
Q: Complex methods of bacteria staining Gram staining technique 3. Properties of gram-positive and…
A: Introduction: Bacteria can be divided into two types: Gram-positive and Gram-negative. Gram…
Q: Which of these conditions are always true of populations evolving due to natural selection?…
A: The mechanism by which communities of living things adapt and evolve is known as natural selection.…
Q: 8-The definitive host of Toxoplasma gondii (Toxoplasmosis), is: A-Cat B-Pig C-Birds…
A: Introduction: Most warm-blooded animal species, including humans, are infected by the protozoan…
Q: he: Small birds mutating their beak genes with the result that later- generation offspring have…
A: Natural selection is a phenomena first given by Charles Darwin. Acccording to this process nature…
Q: An infertile couple was advised to undergo In vitro fertilization by the doctor. Out of the options…
A: In vitro fertilization (IVF) is a process of assisted reproduction in which eggs are surgically…
Q: Part 4: Answer each of the following questions. You must include a Punnett square to support each…
A: The genotypes of a certain cross or mating study are predicted using the Punnett square, which is…
Q: Describe and drawing the reproductive cycle of the fungus Penicillium notatum
A: Penicillium reproduces both asexually and sexually. The asexual stage however, is dominant and…
Q: During a one-year period, a population of rabbits has a birth rate of 0.8 and a death rate of 0.1.…
A: The change in a population is governed by the number of births and deaths. If the birth rate is…
Q: Brucellosis
A: Infection: It is defined as the invasion of the tissues by pathogens, their multiplication and the…
Q: b) Relate how the predator-prey cycle is a form of density-dependent population control.
A: ANSWER: Because of the inverse link that exists between the populations of predators and their prey,…
Q: Which WBC count represents leukocytosis? A.)3500 B.)8700 C.)12,400 D.)6600
A: White blood cell count ( WBC) indicates the number of fighting cells that are necessary for immunity…
Q: 0 НО-Р-О-Р-О- ОН ОН ОН NH₂ N N
A: E
Q: DNA is comprised of four different bases. What are the four different bases? What is so significant…
A: Introduction : The full form of DNA is deoxyribose nucleic acid. It carries genetic information from…
Q: Explain the steps for the reproduction of slime mold according to the image !
A: A variety of distinct eukaryotic organisms having a life cycle which comprises a free-living…
Q: 1. As DNA engages in semi-conservative replication, explain what the following enzymes roles are in…
A: The process of replication follows a semi-conservative model and approach. In this process, DNA…
Q: DNA Nano measurements: width of the helix, spacing between nucleotides Use the functional groups…
A: My synthetic nucleotide would have a thymine base connected to a deoxyribose sugar and a phosphate…
Q: 6. What is the term for the number of offspring a population could produce if no limits were placed…
A: "Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: MAKE A DECISION: Which approach would you recommend to Catarina during her pregnancy? Catarina…
A: Pregnancy is the state of being pregnant or having a fertilized egg implanted in the womb, which…
Q: What is the difference between a general transcription factor (like sigma 70) and a regulatory…
A: Introduction : In order for genes to be expressed, DNA must first be copied into an RNA molecule, a…
Q: Which of the following is most likely to be true of two modern organisms that have a distant…
A: Evolutionary relationships are the association between two organisms on the basis of their ancestral…
Q: Distinguish between sensory and motor pathways in terms of direction and type of information…
A: In motor pathways the direction of information flowed from the cortex to the spinal cord and motor…
Q: Which of the following is an example of positive feedback? A rise in body temperature triggers…
A: Positive feedback This feedback refers to a mechanism in which the product of a reaction leads to…
Q: Which of the following statements related to intercellular junctions is false? Cadherins are…
A: The extracellular matrix facilitates cellular communication within tissues by inducing chemical…
Q: The Okazaki fragment is formed a) near the replication fork. b) on the lagging strand.…
A: According to the definition, DNA fragments created during DNA replication is called Okazaki…
Q: Use the given terms (in parentheses) to complete the following sentences. (closed square, controlled…
A: pedigree:- 1.Due to the limitations of studying humans investigations rely on pedigree analysis.
In order to do electron microscopy the samples had to be specially prepared. Were the cells alive at the time of viewing? Explain why you said yes or no
I need help answering this queshtion the answer is with the article and it has to be as short as possible
URL: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/
Step by step
Solved in 2 steps
- what is plaque essay? what is the purpose of this lab? why this lab is perform? (bacteriophage) what techniques is used and how can we derive information(data)? methologies, theory, mechanism for reactions that lead to observable results. required information on microbial metabolism. why is the microbe doing this?You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTQUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
- Difference between Capsule and Microcapsule in bacteria.of bacteria. The Gram stain works because of differences in the O 1) cell membranes O 2) genetic characteristics O 3) capsules O 4) antigens O 5) cell wallsWhat is the group of bacteria found in both the rumen of cattle and shidge of sewage treatment?Please provide the answer with a plagiarism-free proper explanation. Kindly also refer to the NCERT 12th Biology.
- All of the following are possible configurations of bacteria EXCEPT? Monococcus O Streptococcus Diplococcus OLactobacillus Which of the following is NOT an accessory organ in the digestive system? Liver Pancreas Duodenum Gall bladderBacteria per Gram of Beef After Temp. (°C) 6 hr 12 hr Staphylococcus 43 140,000,000 740,000,000 aureus 51 810,000 59,000 53 650 300 Salmonella 43 3,200,000 10,000,000 Typhimurium 51 950,000 83,000 53 1,200 300 Clostridium 43 1,200,000 3,600,000 perfringens 51 120,000 3,800 53 300 300 Draw the growth curves for each organism. What holding temperature would you recommend? Assuming that cooking kills bacteria in foods, how could these bacteria contaminate the cooked foods? What disease does each organism cause?What is meant by the term "staphylococcus"? O Bacteria that are round and arranged in clusters Bacteria that are round and arranged in chains Special bacteria that are spiral-shaped O Bacteria that are rod-shaped and found in groups Which of the following is false regarding a DNA molecule? It contains a double helix structure It stores genetic information It contains the nitrogen base Uracil It contains base pairs
- Discuss the contributions of Lister, Pasteur, and Koch to the germ theory of disease and the treatment or prevention of diseases. What other contributions did Koch make to microbiology?What is meant by the term “staphylococcus”? Bacteria that are round and arranged in clusters Bacteria that are round and arranged in chains Special bacteria that are spiral-shaped Bacteria that are rod-shaped and found in groupsNaming and Classifying Microorganisms 1. Recognize the system of scientific nomenclature that uses two names: a genus and a specific epithet. 2. Differentiate the major characteristics of each group of microorganisms. 3. List the three domains. A Brief History of Microbiology 1. List at least four beneficial activities of microorganisms. 2. Name two examples of biotechnology that use recombinant DNA technology and two examples that do not. 3. Explain the importance of observations made by Hooke and van Leeuwenhoek. 4. Compare spontaneous generation and biogenesis. 5. Identify the contributions to microbiology made by Needham, Spallanzani, Virchow, and Pasteur. 6. Define bacteriology, mycology, parasitology, immunology, and virology. 7. Explain the importance of microbial genetics and molecular biology.