How are poly-adenosine tails added to subgenomic mRNAs of RNA viruses? Repeated uracil bases on the template cause the polymerase to slip backwards and recopy the sequence Polymerases copy a 200 base string of uracils found in some RNA viral genomes Polymerases copy a 200 base string of uracils added to the template during circularization Viral mRNAs undergo post-translational modifications, which include splicing of introns, a 5'-cap, and a 3'-poly-A tail
Q: why is outcome measure of a cancer program important?
A: The objective of this question is to understand the importance of outcome measures in a cancer…
Q: below you will sketch the difference between cells that go through mitosis versus meiosis. the focus…
A: Q.Explanation:- Mitosis and meiosis are two modes of cell division. Mitosis is known as equational…
Q: In a cross between a black and a white guinea pig, all members of the F₁ generation are black. The…
A: For the question we need to make punnet square, which is a diagram which shows the possibilities in…
Q: Question 2: Now complete the sketch for an XY human male cell undergoing spermatogenesis if a…
A: Keeping track of the sex chromosomes, this explanation will walk you through the process of…
Q: The K and L genes are linked and 6 map units apart. In the cross Kl/kL x kl/Kl what fraction of the…
A: Genes: K and L, two related genes, are situated six mapped units apart on the same…
Q: 5. a. Is genetic drift a gain or loss in heterozygosity? b. What population is most effected by…
A: Genetic drift is a mechanism of evolution that describes the random fluctuations in allele…
Q: 3) Round seeds are dominant over wrinkled seeds in pea plants. Fill in the Punnett square and the…
A: Given-The dominant trait is Round Seeds and is designated by = RThe recessive trait is Wrinkled…
Q: Question 3: If a karyotypically normal egg was to be fertilized by a sperm from question 1, what are…
A: A: 2n=46: This is the normal diploid number for humans, resulting from the combination of 23…
Q: Please make a concept map only Why has the evolution of resistance to insecticides in mosquitoes…
A: Evolution is the process of accumulation of genetic differences in the living organism over a period…
Q: 37) The recessive alleles k (kidney-shaped eyes instead of wild-type round, c (cardinal-colored eyes…
A: This is the three points cross, cross between three genes i.e., k, c and eHere given,k c e 3 = Dcok…
Q: Which type of competition does not happen between members of the same species?…
A: The question is asking to identify the type of competition that does not occur between members of…
Q: Explain why the substances given below dissolve well in the solvents given below. Article Ь, KCI NaF…
A: Iodine (I₂) in Water (H₂O):While I₂ is nonpolar, it can dissolve in polar water to a small extent…
Q: Consider a couple: a woman who is homozygous for a recessive mutation that causes X-linked…
A: The topic at hand revolves around the inheritance patterns of X-linked colorblindness within a…
Q: Individuals increasing sweat production implies that they have acclimatized to the change in…
A: The objective of the question is to understand whether an increase in sweat production in…
Q: Which of the following could you categorize as plankton? O Fish larvae O Jellyfish O Diatoms…
A: Generally speaking, plankton refers to a broad category of mostly minute aquatic creatures suspended…
Q: I have a pet amoeba. It's name is Stretch. I look at stretch every day with my microscope, feed it,…
A: In discussing the fascinating scenario of Stretch the pet amoeba reproducing through mitosis and…
Q: What are best examples for a cancer program planning component by using a logic model
A: The objective of the question is to identify the best examples of components in a cancer program…
Q: Suppose an organelle contains 0.03 M KCI and 25 mM NaCl. How many grams of sucrose would you need…
A: This permits the study of the organelle in its native state and aids in maintaining its…
Q: Upon observing a golden eagle flying overhead, a prairie dog on "guard duty" gives a warning call to…
A: Altruistic behavior is the behavior that is shown by organisms that benefit others, even at the cost…
Q: The following questions are about cis-regulatory elements (CRES). a. Describe the role of regulatory…
A: A. Rule of regulatory elements in eukaryotic gene expression.1: Regulatory elements are parts of…
Q: A young couple went to see a genetic counselor because each had a sibling affected with cystic…
A: Cystic fibrosis is an example of autosomal recessive disorder. The recessive mutant allele is…
Q: was diagnosed with anemia and then heard It is possible that I have leukemia. From my test results…
A: Leukaemia is a cancer of blood cells. Cancer occurs when specific kinds of cells lose the regulation…
Q: What is the pH of stomach juices?
A: The objective of the question is to determine the pH level of stomach juices, also known as gastric…
Q: Why is a specialist more likely to be an endangered species? because they…
A: The question is asking why a specialist species is more likely to become endangered compared to…
Q: Order these groups in order of diversity : Phylum Porifera Phylum Cnidaria Phylum Platyhelmenthes…
A: To order these phyla in terms of biological diversity, we'll consider the number of species, variety…
Q: You are part of a desert plant research team trying to discover crops that will be productive in…
A: First, the plant's numerous drought responses are known to exist, indicating that it has defenses…
Q: Labels Dense irregular connective tissue Ground substance Gland ducts Elastic fibers Bundles of…
A: Tissue is a part of structural organization of body which is composed of numerous cells There are…
Q: From the images, what can you infer about the wings of the bat and the butterfly?
A: Understanding the anatomical features of various winged creatures provides valuable insights into…
Q: In Drosophila, miniature wings (X) result from an X-linked allele that is recessive to the allele…
A: Sex determination in Drosophila melanogaster, commonly known as the fruit fly, is controlled by a…
Q: Straight hair is dominant to curly hair. Which parents will give a 25% chance of having offspring…
A: The objective of the question is to determine which pair of parents will have a 25% chance of…
Q: When the cells of our body are in dire need to synthesize Ribose 5 phosphate and it has already…
A: The objective of the question is to determine the number of glucose 6 phosphate molecules that would…
Q: Slide 1: I need help counting how many stomata there is in this sample.
A: Small controlled pore complexes called stomata are found in the outermost layer of leaves and other…
Q: If two chromosomes of a species are the same length and have similar centromere placements and yet…
A: SolutionC) Loci are differentThe term locus refers to the specific physical location of a gene or…
Q: 1) Define internal myopia, external myopia, normative myopia and de facto myopia. Here I am looking…
A: This refers to a lack of understanding or awareness of one's own limitations, biases, and internal…
Q: What is the particular danger created by operating in the area of the endotracheal tube? How is it…
A: Answer:- The endotracheal procedure involves inserting a flexible plastic tube, known as an…
Q: 7. Five hundred mice from an isolated population were trapped and classified for genotype at one…
A:
Q: Describe at least two communication tools or techniques are effective to use during the cancer…
A: 1. Regular Team Meetings: Regular team meetings are crucial at all stages of the cancer program,…
Q: In Lab 3 you determined the rates of enzyme activity and fermentation. If we want to know how smoke…
A: You can calculate the slope of the line using the formula, to determine the rate of phagocytosis for…
Q: Frequency of allele A, 1.0 0.8 0.6 0.4 0.2 0.0 20 100 Choose all that apply. This figure refers to…
A: The question you described seems to be based on the concept of genetic drift, which is a random…
Q: In humans, blue eyes are inherited as a recessive autosomal trait and color blindness is an X-linked…
A: The objective of this question is to determine the probability of a couple having a child with blue…
Q: A B C CM TO-34 T0-65 T0-85 G CM TO-34 C G M TO-21 TO-25 T0-34 G Figure 2. Amplicons obtained by PCR…
A: Primer combinations for cry1la-CNPA:(A) 3 F/2R (0.52 kb);(B) 1 F/3R (0.44 kb);(C) 5 F/2R (2.1…
Q: Solute molecules are in a beaker of water that is divided by a selectively permeable membrane.…
A: Equilibrium in a system occurs when the rates of forward and backward processes are equal, resulting…
Q: How important are cordinators in an adolecent drug initiative program
A: The objective of the question is to understand the significance of coordinators in an adolescent…
Q: For each of the following, choose whether it is true of sexual reproduction or asexual reproduction.…
A: Answer: Asexual reproduction In asexual reproduction, individuals produce offspring without the need…
Q: nstructions: Kindly answer the following and make sure to include references for each answer. 1.…
A: Please repost the remaining question separately.
Q: Explain how the design and implementation of a pharmacist-directed preventive care program case…
A: The case study article on the design and implementation of a pharmacist-directed preventive care…
Q: table below shows the characteristics of four different blood cell types in terms he outer membrane…
A: Monocytes are immature precursors to mature macrophages. Monocytes migrate from the blood to the…
Q: Which of the following are important biotic factors that can affect the structure and organization…
A: The objective of the question is to identify the biotic factors from the given options that can…
Q: The image below shows a squid dissection. Press the hotspot that indicates the structure used for…
A: Squids are intelligent, quick-moving aquatic molluscs with ten tentacles. Their tentacles grab food,…
Q: Question 1. You may have noticed that in each of the three treatments, a portion (20%) of the field…
A: The objective of the first question is to understand the purpose of leaving a portion of the field…
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.Which of the following characterize RNA polymerase Il transcriptional termination in eukaryotes? Endonuclease cleavage of the RNA transcript and 5' to 3' exonuclease activity a protein known as Ratl None of the provided answers, transcriptional termination occurs in prokaryotes. Recognition of the transcriptional stop codon by a release factor. Hairpin structure formation on the newly synthesized RNA molecule which disrupts the DNA-RNA hybrid at a poly-U RNA sequence Binding of the Rho protein.
- What is its functional difference with the RNA polymerases found in both eukaryotic and prokaryotic cells?Ribosomal RNA in eukaryotic cells is synthesized by which of the following enzymes (exhibiting no sensitivity to either high concentrations or low concentrations of the fungal poison a-amanitin)? RNA polymerase I RNA polymerase II RNA polymerase III DNA polymerase II DNA polymerase IHere is a partof the mRNA sequence of the spike glycoprotein of the SARS Covid-19 virus, starting with the start codon. A deletion was found in 6 bp (underlined). How will this change affect the polypeptide sequence? >S_protein AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACGUGGUGUUUAUUACCCUGACAAAGUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGGACCAAUGGUACUAAGAGGUUUGAUAACCCUGUCCUACCAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUA
- In not more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleusGive the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction
- Azidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the application of this nucleoside analog as an antiviral drug and how it affects reverse transcription and therefore block the ability of the virus to hijack the host cellIn eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule? Group of answer choices Because a guanosine cap has to be removed Because exons have to be removed Because a poly-A tail has to be removed Because introns have to be removed Because the RNA primer has to be removedThe following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?