Given Poly-L-Lysine and Epsilon Poly-L-Lysine, which polymer(s) can easily dissolve in a saline solution with a pH=7 and at room temperature.
Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for...
A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's charac...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm. Pyru...
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH2OH C=O H-C-...
A: Enzymes catalyse the reaction either by making or breaking the bond. They might form double bonds or...
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown b...
A: The rate of enzyme catalyzed reactions is directly proportional to the substrate concentration. But,...
Q: - TRUE about the peptide bond:
A: With the loss of a water molecule, a covalent link is formed between the -amino group of one amino a...
Q: Explain briefly the role of the following Vitamin A in vision Vitamin C in collagen formation Vit...
A: Vitamins are micronutrients, which are required in small amounts by the body. Vitamins are classifie...
Q: Eukaryotic RNAs, such as tRNA and rRNA use different RNA Polymerases. True False
A: Eukaryotic transcription:- In Eukaryotes, 3 different kind of RNA polymerase are used.
Q: It is known that 80% of Penicillin is protein bound. Explain how most of it is being cleared from th...
A: Penicillin is an antibiotic and a beta lactam drug. Penicillin upon administration into humans , go ...
Q: In the third video, glucose, glycine and maltose are tested as samples with the Benedict's reagent. ...
A: Introduction: The benedict is used for the detection of simple carbohydrates. It identifies the redu...
Q: Choose among proteins A, B, C, and D. 1. Protein that will most strongly bind to an anion exchange ...
A: Chromatographic techniques are used to separate specific molecules from a mixture of different molec...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: Giveee a sufficient biosynthesis for this compound starting from acetyl CoA, S-alanine, S- adenosyl ...
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep p...
Q: Which of the following is NOT a unit of concentration? All of these options are units of conce...
A: The specific activity is the activity of the enzyme present per milligram of the total enzyme.
Q: Calculate the actual free energy of hydrolysis of ATP, delta Gp in the erythrocytes of a new species...
A: Actual free energy (∆G) is the maximum amount of energy which is available to perform work. Standard...
Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in a...
A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often acc...
Q: Which of the following is an incorrect grouping of amino acids based on their properties of the side...
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain ...
Q: Differentiate sweet molecules in Column A using the criteria in column B.
A: Acesulfame - K and Aspartame : Acesulfame - K also called as Ace K or acesulfame potassium , it was...
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins ...
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers produc...
Q: Suggest, which enzyme pathway come into play
A: Phenylalanine is an aromatic and non-polar amino acid, it is both glucogenic (Fumarate) and ketogeni...
Q: Lys and Arg Glu and Lys Pro and Asp Among these amino acid combinations listed above, only the combi...
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. All prot...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Allosteric enzymes are th...
Q: Which of the following is correct pairing of concepts? * A. Male sex hormones: androgens B. Preg...
A: Hormones are the body's chemical messengers that travel in our bloodstream to organs, skin, muscles,...
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown b...
A: To determine the values of km and Vmax by lineae regression, we need to plot lb plot. LB plot can be...
Q: The questions ask you to identify which compounds have a specific functional group. For each compoun...
A: Here all the compounds given are organic compounds with Carbon and hydrogen back bone structure. It ...
Q: Differentiate sweet molecules in Column A using the criteria in column B.
A: Given: column A has two components which differs at different aspects as given in column B.
Q: What type of mutation can we get if we use phones and laptops too much
A: Phones and laptops are widely used gadgets nowadays . These devices emit the harmful electro magneti...
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA GA...
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by...
Q: His + Asp +Arg will engage this specific interaction * A. Hydrogen Bonding B. Disulfide Bonds C. N...
A: Introduction: Proteins are building blocks of life and they are made up of carbon, hydrogen, oxygen...
Q: During the formation of the peptide bond which of the following takes place? a. Hydrogen atom is lo...
A: Between the α-nitrogen atom of one amino acid and the carbonyl carbon of another, a peptide bond, al...
Q: Provide one important function of activated APC?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: RNA processing events include A. self splicing B. methylation of 45S FRNA C. snoRNA facilitates meth...
A: Introduction: RNA processing involves newly transcribed RNA molecules (primary transcript) undergoin...
Q: Which of the following enzymes is the key regulatory step in glycolysis? Phosphofructiokinase-1 is t...
A: Glycolysis is a series of reactions that break down glucose into two three-carbon molecules known as...
Q: For each polypeptide derived in the following sequences: 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC U...
A: Polypeptides are composed of amino acids linked to each other via peptide bonds. The peptide bond i...
Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À...
A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate goo...
Q: 2 Two version of the same enzyme were isolated, a wild type and a mutant differing at a single amino...
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy...
Q: a reasonable biosynthesis for Compound 14 starting from Propose alanine, S-phenylalanine and ATP.
A: Given compound in a figure is Aspartame. It is an artificial sweetener and is made by dipeptide of a...
Q: 1. Protein that will most strongly bind to an anion exchange column: [ Select] 2. Protein that will ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: For beta-oxidation of an 18:1 oleate mono-unsaturated fatty acid: - How many Acetyl CoA produced? - ...
A: Fatty acids are molecules with hydrocarbon chain and carboxylic acid group. In the absence of glucos...
Q: What are the biomolecules that are used to biosynthesize a purine ring in the de novo pathway – prov...
A: Purine de novo synthesis is a time-consuming process. It happens actively in the liver cytosol, wher...
Q: What are nucleosides?
A: Nucleosides are compounds consisting of purine or pyrimidine bases linked to sugar. The nucleobase c...
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius - 7 cm; m...
A: Centrifuge is a device used for separating molecules having different densities. The process is call...
Q: lysozyme was purified through G50 beads. From your lab experience, you can determine that when going...
A: Chromatography is biochemical separation method for organic molecules or solutes of a compound so...
Q: 8. Why are histamine and serotonin contents increased in the site ol inila latory?
A: Histamine is an organic nitrogenous compound which is synthesized from amino acid residue L-Histidin...
Q: Biochemistry Question: Give one example of 5-Carben Sugar
A: Introduction: A five-carbon sugar found in the DNA is deoxyribose. It forms the central molecule in ...
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed f...
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of th...
Q: ssume that you have radioactively labeled an amino acid in a glass of milk. Also assume that you hav...
A: Introduction: The term digestion refers to the integration of complex nutrients into simple, soluble...
Q: Which of the following statements about cancer is false? (a) oncogenes arise from mutations in proto...
A: Proto Oncogenes are the genes that cause cancer when get altered. There are several factors that con...
Q: Chargaff rule applies to a ss RNA b All Polynucleotides c ssDNA d dsDNA
A: Chargaff rule was stated by Austrian born chemist Erwin Chargaff. The specifies about the 1:1 ratio ...
Q: An effort is usually made to purify a protein fırst, before its characteristics are determined. True...
A: Purification of a protein is done to get the interested protein in as native form it can be. Purific...
Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...
A: Amino acids are organic compounds with functional group namely carboxyl and amino. Amino acids make...
Given Poly-L-Lysine and Epsilon Poly-L-Lysine, which
Step by step
Solved in 2 steps
- In kappa and iota carrageenans, gels are formed through double helical formation of two polysaccharide segments via covalent interactions. True FalseRelatively hydrophobic proteins will require higher amounts of (NH4)2S04 to precipitate.Draw the structure of pentapeptide Trp-Asp-Cys-Lys-Gln that would predominate in aqueous solution at pH=5.5. (Relevant pKa values are 2.2, 3.8, 8.3, 9.6 and 10.5.)
- Nucleic acid polymers can be inherently stable or unstable. What confers this level of stability and why is this important physiologically?What is the charge on the following peptide at standard biochemical pH? S-Y-D-F-K-I-V-F-L-L +2 -1 0 0 0-2 O +1The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then trypsin (3 fragments total). The mixture of fragments was buffered at a pH 8.5 and then chromatographed on an anion-exchanger (positive resin) with the same buffer. Draw sequence (abbreviated form) of all fragments at that pH (show charges) and predict elution order.
- In a mixture of five proteins listed, draw an elution profile (Absorbance vs. mL eluted, arbitrary) for the purification of the listed proteins on a gel filtration chromatography resin: cytochrome c (pI = 5.4; Mr = 13,000), immunoglobulin G (pI = 7.3; Mr = 145,000), ribonuclease A (pI = 9.6; Mr = 13,700), RNA polymerase (pI = 6.3; Mr = 450,000), human serum albumin (pI = 5.4; Mr = 68,500). Label your elution peaks. Draw a sketch of an SDS-PAGE, reflecting the mobility of the above mixture as they elute from the column. Label you protein bands.Ala-Phe-Pro-Cys-Clu-Arg-Arg-Pro-His-Gly-Lys-Clu Calculate the net charge on the polypeptide at a. pH 1.5 b. pH 8 c. pH 13Based on the following titration table of Glycine, would you be able to recreate the same for Histidine? Glicina Increasing pH H-N-CH,-COOH -H-N-CH,-co = H-N-CH,-C00- Net charge: +1 pH COOH-pKa = 2.3 NH3-pka = 9.6 CN AEq +1 +1 2.3 (0.5°-1)+(0.5°0)=-0.5 +0.5 0.5 9.6 -1 (0.5*+1)+(0.5°0)=+0.5 -0.5 1.5 14 Given that the pKas for Histidine are the following: pka1 = 1.82 pKa2 = 9.17 pКаз %3 6.00 pL = 7.59 2.
- 80mL of a 0.3M solution of hexapeptide Leu-His-Cys-Glu-Asn-Arg is adjusted to pH=pl. The solution is then titrated with 0.2M HCI to a final pH of 2.1. Sketch the titration curve, labelling the pH and volume axes. Indicate the volume of HCl needed to reach each relevant pKa value and equivalence point(s). Relevant pka values are: 2.1, 4.3, 6.0, 8.3, 9.8, and 12.5.What is the practical advantage of the approximate red cell suspension over the exact red cell suspension?Lysozyme consist of 4 disulfide bridges while Bovine Serum Albumin(BSA) is 17. However, lysozyme is more rigid compared to BSA. Why? What are the factors affecting the rigidity of their structures? Does the number of α-helixes and β-sheets matter?