Figure 3: /Zea mays/ Shoot tip 7 12 11 10 8 For questions 7-12, refer to Figure 3. Identify the apical meristems (green), primary meristems (red), and other structures (blue) pointed.
Q: In a recent influenza epidemic, physicians were utilizing a rapid diagnostic test to determine which…
A: Influenza It is a viral infection caused by influenza virus. This virus infects the respiratory…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: The process of synthesis of proteins from mRNA is called as translation while the process of…
Q: what are 4 antagonistic interaction between two or more species that are exploited to improve…
A: Antagonist interaction between two species is the negative interaction where one species is…
Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…
A: Aorta is the largest artery that carries oxygenated blood to rest of the heart.
Q: Distinguish between monohybrid, dihybrid and test crosses. Maximum number of characters (including…
A: Difference between monohybrid and Dihybrid test cross are given below -
Q: Many amino acid biosynthetic operon under attenuation control are also under negative control.…
A: In bacteria, transcriptional attenuation is a common means of regulating gene expression in response…
Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…
A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…
Q: Question - What is biology? A) The study of DNA. 3) The study of the environm C) The study of life.…
A: Science is the intellectual and practical activity encompassing the systematic study of the…
Q: How does natural increase, natural decrease, equilibrium affects or influence the population and…
A: Typically, population refers to the number of people in a certain place, such as a city or town,…
Q: 8. If the molecular weight of E. coli DNA is taken as 2.7 x 10° and the average molecular weight of…
A: Nucleic acids are essential for all forms of life and are found in all cells. Nucleic acid comes in…
Q: f your 16x concentrated stock solution contains 20g of Nacl per liter, how much Nacl would one liter…
A: Given:- Concentration of stock solution= 16X NaCl required per litre= 20g NaCl required for 1 litre…
Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: 9. Coronary arteries route oxygen leH of the: d. descending aorta halpern round-a-bout a.…
A: Coronary artery supplies the fresh blood to the heart wall. It is of following types-Left anterior…
Q: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…
A: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…
Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…
A: PT test is the normal blood test conducted to record the time taken for blood to clot.
Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…
A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…
Q: What information does the Shannon index provide? What different factors should you consider before…
A: The Shannon diversity index calculator is a tool that may be used to estimate species diversity in a…
Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…
A: Sound is defined as the vibrations that travel through the air or another type of medium as an…
Q: You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You…
A: INTRODUCTION In chemistry, pH traditionally denoting "ability of hydrogen" is a scale used to…
Q: Can you explain which answer is accurate and why it's the correct choice?
A: The bottleneck effect describes how a population's size is reduced and then increased, affecting the…
Q: Glycogenolysis is considered to be which of the following? Group of answer choices an example of…
A: Metabolism is a phenomenon takes place inside the body of an organism in which material are either…
Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. a. b. C.…
A: The sodium-potassium pump is an example of an active transport membrane protein/transmembrane…
Q: To summarize: The concept of energy flow through a food web.
A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…
Q: In a population of snapdragons, at the locus controlling flower color you find that 0.2 are AA, 0.65…
A: Given: AA = 0.2 Aa = 0.65 aa = 0.15 Need to find the inbreeding coefficient.
Q: How does RhoGAM prevent HDN? A) it is an antigen that binds to and inactivates anti-Rh antibody from…
A: Introduction Antibody:- It is a protein made by plasma cells (a type of white blood cell) in…
Q: Fetuses whose cells are triploid, that is, contain three full sets of chromosomes, develop to term…
A: INTRODUCTION The DNA molecule is packed into thread-like structures called chromosomes in the…
Q: Lichens are formed by an association between: fungi and plants O algae and plants O protists and…
A: Introduction Ecology:- It is the study of the relationship between living organisms and their…
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: Transcription Formation of RNA over DNA template is called transcription. Translation The process…
Q: Describe the function of the key Agrobacterium proteins involved in the transfer and integration of…
A:
Q: Which of the following would apply to desmosomes that are found in cells as they migrate from the…
A: The stratum corneum is the outermost layer of the epidermis and it marks the final stage of the…
Q: Provide an illustration and describe the different types of egg as to the concentration of yolk they…
A: Isolecithal eggs : It is a type of holoblastic egg.. In this type yolk distribution is same that is…
Q: Based on the past activities about constructing of phylogenetic trees, how do you distinguish…
A: When the evolution of different organisms or species from a common ancestor is depicted through a…
Q: 5. Which of the following can increase mean arterial pressure (MAP) in an individual? I. II. III.…
A: Given : Mean arterial pressure (MAP) is defined as the average arterial pressure that happens…
Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…
A: O-antigen plays a very important role in microbes and host interaction. It is generally present in…
Q: Which of the following does NOT play a role in DNA replication? O helicase promoter O ligase…
A: ANSWER;- None of the above Explain;- Does not play a role in DNA replication is a stop codon. -Stop…
Q: The hydrolysis of ATP requires a. energy. b. water. C. a high temperature. d. energy and water. e.…
A: Answer is.. Water (b)
Q: Instruction: Using the data on the situation below, compute for the Hardy-Weinberg equation to…
A: Here the orange goldfish crackers are dominant & the white goldfish crackers are recessive. The…
Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…
A: As stem cells are the cells which have the ability to divide and can give rise to many different…
Q: 6. The physiological action(s) of insulin is (are): I. To increase glucose uptake II. To increase…
A: Insulin is a peptide hormone produced by beta cells of the pancreatic islets, and it is regarded as…
Q: Chromosomes align at metaphase plate equidistantly from the opposite pole to avoid unequal…
A: Metaphase It is the fourth stage of the division of the cell. It is the stage in which the…
Q: Reproduction that involves two parents is called. Asexual reproduction Behaviour Genetics Sexual…
A: Biology is the study of life or living matter in all of its forms and manifestations, with a focus…
Q: The probability of having an individual with a least a heterozygous gene pair on its genotype from…
A: The two genes are involved in this case. That's why it is a case of dihybrid cross.
Q: O Ferquency O haematuria O oliguria
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: What is the principle behind a UV-Vis spectrophotometer, and what are its key components, and how…
A: UV-vis spectrophotometry or UV spectroscopy types of absorption spectroscopy or reflectance…
Q: Explain the process of seed development in a typical angiosperm plant. 2. Describe the two -stage…
A: Angiosperms are flower-bearing plants and are the most diverse group of terrestrial plants. The…
Q: Explain the difference between Place and Stimulus-Response learning strategies. Include the…
A: The activation of Brain sources that occur in response to auditory, visual and audiovisual stimuli…
Q: It is important for elderly persons to get enough immune systems. to help boost their aging O a)…
A: The vitamins A,D,C and zinc help in building a good immune system and in the better functioning of…
Q: Describe in detail the relevance of apoptosis to cancer therapy
A: Apoptosis or programmed cell death It is a highly regulated process that allows a cell to self…
Q: To explain: The typical pyramids of numbers, biomass, and energy.
A: The sun provides energy to the Earth and actually defines that they're supposed to form through and…
Q: Pyruvate from glycolysis is oxidized by ATP. in the mitochondrial matrix. a. b. to release water. C.…
A: Aerobic respiration :- it is the process of cellular respiration that takes place in presence of…
Step by step
Solved in 2 steps
- Figure 3:IZea mays/ Shoot tip 7 12 11 9. 10 8 For questions 7-12, refer to Figure 3. Identify the apical meristems (green), primary meristems (red), and other structures (blue) pointed.Identify the tracheid and other parts that are visible.Image is a macerated stem of Hibiscus rosasinensisPlease label the diagarm with the words
- Compare the ST and CT treatments in Figure 4 to the other treatments (T1, T2, T3, and T4). What do the controls show about the experimental treatments? (Choose one.) Group of answer choices Only F. kuroshium and N. metavorans are pathogenic to the fig trees, and disrupt movement of xylem sap through the plants. Conductance of xylem sap is not a good measurement of the degree of fig wilt disease in fig saplings. All of the fungi tested are pathogenic to the fig trees, and disrupt movement of xylem sap through the plants. F. kuroshium by itself is not pathogenic to fig saplings, C. facicola by itself is pathogenic to fig saplings and also interacts with F. kuroshium to disrupt movement of xylem sap through the fig saplings.Of the circled parts, determine which is/are sclerenchyma cells 50 3 2What happens to the ground and dermal tissues of the parent root as the branch root forms? Explain in 7-10 sentences. Note: Kindly explain the question subjectively and thoroughly. Thank you!
- #9: Identify the section (cut) represented by the picture on the left. #10: Identify the section (cut) represented by the arrow from the stem on the right.Given below is an experimental setup to demonstrate a particular tropic movement in germinating seeds. Study the diagram and answer the questions that follow Perforated trough Moist sawdust - Germinating seed -Brick (i) Label the parts 1 and 2. (ii) Name the tropic movement shown by part 1. (iii) Part 1 is affected by two stimuli. Name them. Which one of the two is stronger? (iv) What is Thigmotropism ? Give one example. (v) What is meant by 'Positive' and 'Negative' tropic movements in plants?Difference between apical intercalary and lateral meristem in class 9
- ___ helps in formation of leafBriefly discuss the origin and function of sebumNow examine the demonstration slide of a c.s. of an immature lily anther and identify the four pollen sacs, or microsporangia (see text Figure 19-14a, page 466). Note the layer of cells immediately surrounding the microspore mother cells (microsporocytes, or pollen mother cells). This is the tapetum. 3. Label the pollen sacs and microsporocytes in Figure 2. below. Figure 2. Lilium immature anther c.s. Photo by Carolyn Alling 4. What is the ploidy level (haploid or diploid) of the microspore mother cell? Of the megaspore mother cells? (29/10 19eal to toping 125