Draw the condensed structure of the smallest organic molecule that produces potassium 2-chloropropanoate when reacted with KOH. Give detailed Solution with explanation needed with reaction, don't give Handwritten answer

Q: None

A: Step 1:Step 2:

Q: 2. The conversion of parahydro into orthohydro was carried out at 923 K. The dependence of the…

A: Thank you,Please rate my response.

Q: Explain the difference between dilute and concentrated solutions.

A: First let's understand solution. Solution is a homogeneous mixture that generally contain two parts…

Q: During the transfer hydrogenation of dehydrozingerone to zingerone ideally the yellow color fades…

A: Certainly! Let's break down the explanation: Step 1: Transfer Hydrogenation of…

Q: 1, Solve the Schrodinger Equation (SE) of particle in a well (PIW) using complex exponential…

A: The image you sent depicts a step to solve the Schrodinger Equation (SE) for a particle in a well…

Q: A cup of hot coffee initially at 100°C cools to 90°C after 15 minutes in a room at TS = 65°C. T =…

A:

Q: Gold is frequently purified by electroplating. Typically the gold is dissolved in a cyanide solution…

A:

Q: What is the major product of the following reaction? CH3 Br₂ ? + H₂O L CH3 IV. CH3 OH Br OH V. CH3…

A: Step 1:

Q: Nitric oxide (NO) reacts with H2 to form N2O and H2O. It is known that there are two elementarysteps…

A: The rate law tells us which is the rate determining step.The slowest step is the rate determining…

Q: Question 3. At 100°C and 16.0 kPa, the mass density of phosphorus vapour is0.6388 kg m-3. What is…

A: Given: T=100.°C;P=16.0kPa;d=0.5388kg/m31kg/m3=1g/dm3=1g/LStep 1: Write the expected molecular…

Q: The equilibrium constant for the reaction below is 0.02 mol dm-3 at 298.000 K.Fructose…

A:

Q: Bro not hand written solution

A: μStep 1:Step 2: Step 3: Step 4:

Q: QUESTION 4 your choice. .ank the following compounds below In terms of acidity and explain CF3CH2OH…

A: Step 1: We know, According to Bronsted-Lowry acid-base theory, an Acid is a H+ donor whereas a Base…

Q: Show by structural drawings the various (if any) stereoregular polymers that might possibly we…

A: Sure, here are the possible stereoregular polymers that could be obtained from each of the mentioned…

Q: www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-IgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9Qllg7siQ-…

A: Step 1:naming process for each molecule:1. 2-Hydroxybutanal  a. Identify the Longest Carbon Chain…

Q: 2. Propose reagents to achieve the following syntheses using an Aldol addition or condensation. Η Η…

A: Step 1: given first reaction is aldol condensation and second reaction is aldol reaction Step 2: in…

Q: 4. Assign E or Z configuration to the following compounds. H3C CH2CH3 a) H3CH2C CH2CH2CI H₂C CH₂Br…

A: In case of any doubt feel free to ask.

Q: Draw the arrow pushing mechanism for the transfer hydrogenation converting dehydrozingerone to…

A:

Q: b) HO H H2SO4 Major prodcut + Minor product I. Heat Br H II. NaOEt Major prodcut + Minor product…

A:

Q: A bubble of methane gas, CH, is released from a deep bog. The temperature at the bottor the bog is…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: Researchers used gas chromatography to determine the % v/v methyl salicylate in rubbing alcohol [Van…

A: ### Step 1: Understand the Principle of Standard AdditionsThe standard additions method involves…

Q: Sighting along the C2-C3 bond of the 2-methylbutane, draw the Newman projection ofconformational…

A: Staggered conformation: also known as anti-conformation, refers to the configuration of atoms within…

Q: None

A: Step 1:The most common ions of aluminum and sulfur are:Aluminum (Al): Al3+ (aluminum cation with a…

Q: Consider the monomers oxalyl chloride and resorcinol, shown below. Draw the structure for two repeat…

A:

Q: :&;$;$:$$:$$;$;

A: It seems like you're describing a series of reactions involving bromine (Br2) under various…

Q: 2. A similar experiment is performed to determine the empirical formula of an oxide of copper, and…

A: Given: Mass of crucible, cover and copper sample = 21.53 g Mass of empty crucible with cover = 19.66…

Q: Part 1)A buffer solution contains 0.125 M acetic acid and 0.150 M sodium acetate. The pKa of acetic…

A: Part 1. Given: [HC2​H3​O2​]=0.125M;[C2​H3​O2−​]=0.150M;pKa​=4.74Step 1: Write the…

Q: ;;////:;()$&&

A: E2 reaction is a bimolecular, single-step elimination reaction in which the base NaOEt (sodium…

Q: a solution of cupric sulphate is used at a blood donor clinic to test donor blood for low iron.…

A:

Q: None

A: Part 2: Explanation:Step 1: The starting material, O-Ph (phenol ether), undergoes hydrolysis to…

Q: Figure out and explain what the reagents would be used in this reaction and show/draw the mechanism…

A: Step 1:• Mechanism • Firstly strong base abstract acidic proton to forms carbanion which further…

Q: Zinc oxide can be used for treating certain skin conditions. Determine the molar mass of ZnO.

A: The molar mass of zinc oxide, ZnO, is the sum of the molar masses of zinc and oxygen. With zinc…

Q: 1. Propose a synthesis of alkyl chloride A, using the following alcohol as a starting material.…

A:

Q: what molar volume of hydrogen gas is needed to react with 1.61 x 1023 formula units of WO3

A: **Step 1: Write the chemical reaction**Tungsten oxide reacts with hydrogen gas to produce tungsten…

Q: The reaction rate can also be described by the rate lawRate = k [S 2 O 82- ] x [I - ] yThe exponents…

A:

Q: At 25 °C, the reaction 2NH3(g) N2(g) + 3H2(g) has Kc = 2.3 x 10-9. If 0.021 mol NH3 is placed in a…

A: Please comment down for any doubt. I hope my answer helps you.

Q: 7. What is the major product? NaOH c. ? a. b. d. e. not a.-d.

A: Step 1: **Substitution Nucleophilic unimolecular reaction, or SN1 :**  1) There are two stages to…

Q: 0.10 M potassium chromate is slowly added to a solution containing 0. 50 M AgNO3 and 0. 50 M…

A: Given:K2CrO4=0.1 M      Ksp Ag2CrO4= 1.1 × 10-12AgNO3= 0.5 M      Ksp BaCrO4= 1.2 ×…

Q: 7) The correct structure that corresponds to the spectroscopic data given below is [IR 2720, 1710 1…

A: compound contains aldehydic group not carboxylic group as HNMR shows peak at 9.8 ppm which is region…

Q: Predict the major products of the following reaction. Be sure to show the stereochemistry of the…

A: Question discussionThis is addition reaction. Alkyne react with 2 moles of HBr to give dibromo…

Q: Provide a concise explanation of Mass spectrometry (MS) in regard to food samples. include the…

A: **Specific Application Name:**Identification and Quantification of Pesticides in Apples**Sample…

Q: Consider oxygen gas characterized by the Van der Waals parameters a = 1.382 bar L2mol-2 and b =…

A: Step 1: Step 2: Step 3: Step 4:

Q: 3. At 25 °C, the groundwater is saturated with CO2 at a partial pressure of 0.2 atm. The pH of the…

A: 1. **Dissolution of CO2 and Formation of Carbonic Acid**:  CO2(g) + H2O(l) ↔ H2CO3(aq)    At 25°C…

Q: Please answer 22

A:

Q: name of this compound????

A: In case of any doubt please feel free to ask.

Q: Answer the questions in the table below about this molecule:

A: Detailed explanation:Identification of the Molecular Structure: The molecule presented,…

Q: What is the pH of a 0.420 M solution of HF (Ka = 6.8 × 10-4)?

A: Given: [HF]=0.420M;Ka​=6.8x10−4;pH=???Step 1: Write the dissociation of…

Q: 2. Balance the following oxidation-reduction reaction in acidic media. You must use the half-…

A: Given: As(s)​+ClO3(aq)−​→H3​AsO3(aq)​+HClO(aq)​The HCO is really HClO. Step 1: Write the…

Q: Draw D-galactose in the most stable chair conformation by applying H, OH and CH2OH the drawing…

A: The first step is to always draw the chair conformation of glucose which is shown below:Dont mind…

Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA

A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…