(b) Bacteriophage 434 repressor SIN Which of the following is true regarding the interaction of the repressor with the DNA 1. Binding occurs within the major groove of the DNA 2. Mutations in the regions that interact can never affect the binding of the two molecules 3. The minor groove is the region of DNA that interacts with the repressor 4. Both A and B are true

(b) Bacteriophage 434 repressor SIN Which of the following is true regarding the interaction of the repressor with the DNA 1. Binding occurs within the major groove of the DNA 2. Mutations in the regions that interact can never affect the binding of the two molecules 3. The minor groove is the region of DNA that interacts with the repressor 4. Both A and B are true

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 2SQ

See similar textbooks

Similar questions

Certain environmental conditions such as exposure to UV light areknown to activate lysogenic λ prophages and cause them to progressinto the lytic cycle. UV light initially causes the repressor protein to be proteolytically degraded. Make a flow diagram showing the subsequent events that lead to the lytic cycle. (Note: The xis gene codes for an enzyme that is necessary to excise the λ prophage from the E. coli chromosome. The enzyme integrase is also necessary for this excision.)
In addition to Tc1, the C. elegans genome contains otherfamilies of DNA transposons such as Tc2, Tc3, Tc4, andTc5. Like Tc1, their transposition is repressed in thegerm line but not in somatic cells. Predict the behaviorof these elements in the mutant strains where Tc1 is nolonger repressed due to mutations in the RNAi pathway.Justify your answer.
Many viruses that infect eukaryotic cells express genes that alterthe regulation of host gene expression to promote viral replication.For example, herpes simplex virus-1 (HSV-1) expresses aprotein called ICP0, which is necessary for successful viral infectionand replication within the host. Lutz et al. (2017. Viruses9: 210) showed that ICP0 can act as a ubiquitin ligase and targetthe redundant transcriptional repressors ZEB1 and ZEB2,which leads to upregulation of the miR-183 cluster (a set of threemiRNAs transcribed from the same locus). Speculate on how miR-183 cluster upregulation may benefitthe virus.
Many viruses that infect eukaryotic cells express genes that alterthe regulation of host gene expression to promote viral replication.For example, herpes simplex virus-1 (HSV-1) expresses aprotein called ICP0, which is necessary for successful viral infectionand replication within the host. Lutz et al. (2017. Viruses9: 210) showed that ICP0 can act as a ubiquitin ligase and targetthe redundant transcriptional repressors ZEB1 and ZEB2,which leads to upregulation of the miR-183 cluster (a set of threemiRNAs transcribed from the same locus). How may ICP0 expression in a host cell lead to upregulationof the miR-183 cluster?
Why can it be said that transcription of thebacteriophage T7 genome requires two enzymes?
The following statement occurs early in this chapter:“. . . a crucial step in the regulation of many bacterialgenes is the binding of RNA polymerase to DNA atthe promoter.” Why might it be advantageous forbacteria to regulate the expression of their genesat this particular step?
Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose you pretreat cells with or withoutepinephrine and then prepare a cell extract that contains theCREB protein.You then use an electrophoretic mobility shift assay to analyzethe ability of the CREB protein to bind to a DNA fragmentcontaining a cAMP response element (CRE). Describe what theexpected results would be.
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
In Figure 12-26, provide a biochemical mechanism forwhy HP-1 can bind to the DNA only on the left side of thebarrier insulator. Similarly, why can HMTase bind onlyto the DNA on the left of the barrier insulator?
(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helix
What is the probability that the palindromic symmetry of the trp repressor target DNA sequence is merely accidental?
Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structure