Analyzing: Each nucleotide in a DNA molecule consists of a: * sulfur group, deoxyribose, and a nitrogen base phosphate group, deoxyribose, and an oxygen base phosphate group, ribose, and a nitrogen base phosphate group, deoxyribose, and a nitrogen base Remembering: Which of the following activities occur during DNA base pairing? * O adenine bonds with thymine thymine bonds with cytosine O thymine bonds with guanine
Q: Explain the rationale behind the separation of different cellular components using centrifuge.
A: Centrifugation: Mechanical separation process which uses centrifugal force to separate components ba...
Q: Glucagon increases blood glucose very quickly by activating phosphorylase. This is very efficient be...
A: Glucagon: It is a hormone secreted by alpha cells of the islet of Langerhans when the level of bloo...
Q: 4. What would be the most possible interaction between the side chains (R-group) of isoleucine and p...
A: The peptide bond is formed between the alpha amino and the alpha carboxyl groups of amino acids and ...
Q: Some cancers are detectable with a simple blood test (if the cancer cells secrete a chemical that ci...
A: Hi thanks a lot for asking the details of the solution. The solution is correct, and amount of chemi...
Q: 2. What is the general name for a monosaccharides which has A. 6 carbons B. 5 carbons C. 3 carbons
A: Monosaccharide- Simplest carbohydrates, sugar and have only 1 sugar molecule.
Q: Who is the father of biochemistry?
A: Biochemistry means the study of biomolecules presents inside biological organisms. It can also be de...
Q: 1,2-dioleoyl-3-myristyl-sn-glycerol sn-16:0-12:0-16:0 LLnO Consider the TAGS above a. Which is most...
A: Triacylglycerides are esters of fatty acids that are hydrolyzed to form glycerol and free fatty acid...
Q: (a) Propose a biosynthetic pathway to the secondary metabolite, B. OH O H. HO Metabolite B
A: The given metabolite structure is derivative of Salicylaldehyde derivative and synthesized by plant ...
Q: 20. The process below is otherwise known as HC OC-(CH) CH, Fat +S H,C(CH)e- Na HC-O-H a. alkali degr...
A: Soaps are the sodium and potassium salts of the long-chain carboxylic acids. Some of the examples o...
Q: 2) Draw the molecular structures of the products obtained when 1-palmitoyl-2-oleoyl-3- phosphatidyls...
A: Phospholipase are the group of enzymes which hydrolyzes the phospholipids into fatty acids. It is cl...
Q: ou have given two proteins with a pI of 4.5 and pI of 7.7? Using an anion-exchange column, how can t...
A: Ion-exchange chromatography: The method involves the separation of ions and polar molecules based o...
Q: Determine whether the following statements describe a reversible competitive inhibitor, a reversible...
A: Inhibitors are the chemical substances that bind to the enzyme and result in a decrease in the catal...
Q: The following compound was obtained from cells, after supplying them with 1"C-labeled pyruvate. The ...
A: Pyruvate is a three-carbon compound that enters the TCA cycle through the pyruvate dehydrogenase rea...
Q: Topic: Isolation of Crude Ovalbumin from Egg White by Ammonium Sulfate Precipitation (Salting Out) ...
A: Ovalbumin is an egg white protein which is responsible for egg white formation and has a molecular w...
Q: Sketch a titration curve for the following amino acids and indicate the pKa values for all titratabl...
A: pKa value: It is a negative log of ka value, which is acid ionization constant or acid dissociation ...
Q: DNA TRANSCRIPTION TRANSLATION REPLICATION (D) DNA template (B] 3'-5' (C) MRNA (E) New (F) Name of (A...
A: Transcription is the process of synthesizing an RNA by the action of a DNA dependent RNA Polymerase....
Q: Which of the following explains why steroids are considered.to be lipids? a) They contain fatty acid...
A: Steroids are not proteins or lipoproteins, but rather molecules that dissolve in and associate with ...
Q: Explain what sets the lower limit of the cell size and the upper limit.
A: The cells are microscopic and invisible to the naked eyes that carry out a variety of tasks. The cel...
Q: lanes for the blue and brown allele samples? (circle one) Brown sample: 0 1 Blue sample: 0 1 2 more ...
A: Agarose Gel electrophoresis is the molecular biology technique which helps in separation of gene se...
Q: Would any of the above give a positive Lieberman-Burchard test? Explain your answer.
A: The endocrine system is a vital biological system that produces various hormones. These hormones ser...
Q: 2. Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in culture...
A: Literally, replication means the system of duplication. In molecular biology, DNA replication is the...
Q: Hello, please answer the questions below about Vitamin C. Name of Vitamin: Vitamin C Classification...
A: Introduction: Vitamins are natural substances found in both plants and animals and it is considered ...
Q: What are the two appropriate control groups if flask 2: ‘Yeast + Glucose + Water’ is your experiment...
A: Flask, Tube, water, 1 tbsp sugar, and 1/8 tsp yeast were used in the control group.
Q: Evaluating: The electron configuration of an atom is 1s22s22p6. The number of electrons in the atom ...
A: 1.1s2 2s2 2p6 ( Count the value that is given in power) 1s2 :- 2 electrons 2s2 :- 2 electrons 2p...
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your ami...
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer ...
Q: What is the effect of cholesterol when they are embedded in membranes? 1. Cholesterol alters the...
A:
Q: What is oxidative degradation in catabolism? and what is reductive biosynthesis in anabolism?
A: Anabolic reactions lead to the synthesis of biomolecules. The catabolic reactions lead to the oxidat...
Q: What test(s) could you perform to test your hypothesis about the greenish precipitate. (Centrifuge ...
A: Centrifugation is the separation process by which the substances get separated on the basis of densi...
Q: Use the Stokes-Einstein equation to estimate the diffusion coefficient in m2/s and in um?/s for the ...
A: The Stoke-Einstein equation is used for calculating the diffusion coefficient of the spherical molec...
Q: Which of these are soluble in water, vitamin C or vitamin K? Explain your answer.
A: Carbohydrates, lipids, and proteins are macronutrients that the body requires in greater quantities ...
Q: Predict or describe the absorbance or enzyme activity at: pH = 2 pH = 14 Temperature = 25°C Tempera...
A: Introduction - The study of reaction rates and how they change in response to changes in experiment...
Q: 1E In terms of binding adenylate kinase, the Kd for ATP is ~50 M and the KI for GMP-PCP is ~50 nM....
A: Kd stands for dissociation constant while Ki refers to inhibition constant. Both the values play imp...
Q: Explain the consequence of the following structures
A: A cell membrane surrounds every cell, forming a barrier between the cell and its environment. The ph...
Q: (b) You are investigating the effects of several agents on the activity of alcohol dehydrogenase. Th...
A: Km and Vmax can be calculated from the graphs that are plotted between substrate concentration and E...
Q: Write the structure of the Monosaccharide (Aldoses Family and Ketoses family)
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the glycosid...
Q: In the first step of the citric acid cycle, an acetyl group from acetyl CoA reacts with oxaloacetate...
A: Citric acid cycle is one of the steps in aerobic oxidation of glucose. It occurs in mitochondrial ma...
Q: When [Et] = 20 nM and [SAD] = 40 µM, the reaction velocity, V0, is 9.6µM s1. Calculate Km for the su...
A: Michaelis menten constant, Km is the substrate concentration required to produce half maximum veloci...
Q: How may genes play a role in the susceptibility of inheriting cancers? The reproductive system discu...
A: Cancer is a disease in which the body's cells grow out of control and spread to other tissues. Any o...
Q: Hello! Please give a slogan for Vitamin C, its food sources and a trivia or important information of...
A: A vitamin is an organic molecule that is an important micronutrient that an organism need in small a...
Q: The following figure shows two absorption spectra. NAD* is the solid line. NADH is the dashed line. ...
A: The method of UV spectroscopy is applied to follow the progress of varied different enzymatic redox ...
Q: After treatment with peroxyformic acid, the peptide hormone vasopressin is partially hydrolyzed. The...
A: Vasopressin, is an important hormone which has multiple functions in the body. It also known as anti...
Q: The Michaelis‑Menten equation models the hyperbolic relationship between [S] and the initial reactio...
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy...
Q: 1. The compound is an ethonalamineplasmalogen. The following tests were done. What are the results t...
A: Ethonalamine plasmalogen are mainly phospholoipids and frequently occur in kidney, lungs, brain and...
Q: An enzyme that works best at pH 2 and temperature 35-39°C was dissolved in water then boiled. Afterw...
A: The function of a protein arises from the three dimensional structure of the protein.
Q: State the purpose of DNA replication and describe the process
A: DNA (deoxyribonucleic acid) is the genetic material which plays an important role in the transfer of...
Q: 4. Which of the following best describe the physical properties of fatty acids? a. All physical prop...
A: The backbone of triacylglycerols is constituted of a glycerol moiety in which all the three hydroxyl...
Q: 1b: Do DNA fragments move towards the positive or negative end of the gel box? Explain your answer. ...
A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts f...
Q: Explain why those biological reactions that have their equilibria shifted towards the products have ...
A: Thermodynamically favorable reactions have a negative value of the change in Gibb's Free Energy. In...
Q: Explain what is meant by “stereospecificity.”
A: Specificity is a key term in biochemistry and mainly used in the study of enzymes. It is the ability...
Q: Determine which of the standard amino acids have a side chain with the following characteristics. C...
A:
Step by step
Solved in 4 steps with 2 images
- Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA molecule without breaking the hydrogen bonds that hold the bases together. indicate how, through such contacts, a protein can distinguish a T-A from a C-G pair. indicate the parts of the nucleotide base pairs that could form noncovalent interactions— hydrogen bonds, electrostatic attractions, or hydrophobic interactions -with a DNA-binding protein.A. Draw a detailed structure of DNA strand using the following sequence of bases 5'A -C- G 3' Show the structure of the phosphate group, pentose sugar and nitrogen containing base B. Why is DNA called the blueprint of an organism?Compare and contrast the structure of DNA and RNA. Be sure to describe each of the three components of a nucleotide for both DNA and RNA along with the types of bonds formed between the components. In addition, explain: how the nucleotides link together to form each molecule, why the prime ends are labeled 5’ and 3’, what antiparallel is, what phospodiester linkages are and what complementary base pairing is.
- Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack upon one another, with 3.4 Å spacing between them. DNA strands having a complementary sequence will spontaneously form a double-helix in an aqueous solution. In terms of energy, what primarily drives helix formation? O Positive Entropy from base stacking van der Waals interactions O Hoogsteen interactions Positive Enthalpy from Hydrogen Bonding between GC and AT pairs Negative Enthalpy from Hydrogen Bonding between GC and AT pairs O Negative Entropy from base stackingWhat is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATTState the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
- . Which of the following equations is a prediction based on Chargaff’s rules for the content of DNA? adenine + thymine = guanine + cytosine thymine + adenine = cytosine + guanine guanine + cytosine = adenine + thymine cytosine + guanine = thymine + adenine adenine + cytosine = thymine + guanineCan you: describe the 2 D and 3 D structure of DNA including the bonding that takes place?What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
- What is the role of GelRed® in Agarose gel electrophoresis of DNA fragments? Please select the single answer that is most correct GelRed® moves down the agarose gel in response to the electric current and enables visualisation of the position of A the nucleic acids within in the agarose gel. GelRed® intercalates with the Nucleic acid and, under UV light, fluoresces to enable visualisation of the position of the nucleic acids in the agarose gel. GelRed® intercalates with the Nucleic acid and enables visualisation of the position of the nucleic acids in C the agarose gel. GelRed® intercalates with the amino acids in the agarose gel and enables visualisation of the position of their in D the agarose gel.Recall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein one complete 3600 turn covers a distance of 34 angstroms (Å) or 3.4 nm and 10 base pairs. As a result, the base pairs are separated by a distance of approximately 3.4 Å. The diameter of the Watson and Crick DNA molecule is 20 Å.Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA double helix according to the dimension mentioned above. Round off your answer to the nearest whole number. Note also that 1 micrometer = 10,000 angstroms.Match the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Complementary base pairs Double helix Antiparallel Nucleotide Hydrogen bonds Deoxyribose sugar