Q: TRUE OR FALSE 1. The antheridium of a moss could be seen as a whole mount at 100x magnification. 2...
A: Question 1 true The size of moss is about 1 to 2cm and the antheridium is about 2mm 100x power ca...
Q: What impact does the time of day, days of the month, or place where the tasks are completed have on ...
A: Clinical psychology is a branch of psychology that provides people and families with ongoing and com...
Q: body
A: Skin colour is largely determined by a pigment called melanin but other things are involved. Your sk...
Q: QUESTION 43 Which of the following statements is true about linkage disequilibrium? O a. D= -0.21 in...
A: Disequilibrium refers to imbalance, or spatial disorientation.
Q: Ecology and thermodynamics
A: Ecology is the discipline of science that studies living species, their environments, and their inte...
Q: how the regulation of DNA expression by the proteins that are bound to it and their inheritance infl...
A:
Q: choose correct option nd do explain shortly plz.
A: The origin of life on earth is backed by numerous theories such as theory of special creation, abiog...
Q: . What are the advantages and disadvantages of using the Hanging drop technique?
A: Introduction :- The hanging drop technique can be used to examine living microorganisms. This entail...
Q: Identify and explain what insects are expected to have the most sclerotized heads? Does an exoskelet...
A: Scelerotin is typically a brown coloured substance found in cuticles of insects. Scelerotin is forme...
Q: Antibiotics should be reduced or eliminated from culture media during cell subculturing. Make it mor...
A: Subculturing, also known as passaging cells, is the process of removing the media from an old cultur...
Q: distinguish between bacterial cells that obtained the plasmid and those that did not
A: Bacteria are single celled organisms with a unique internal structure.
Q: Which of the following enzymes relaxes the DNA double helix to avoid tensional force from supercoili...
A: DNA ligase:- DNA ligase works by catalyzing the formation of a phosphodiester bond between nucleotid...
Q: ds. QUESTION 9 For each of the following chromosome combinations in humans, what is the phenotypic s...
A: Gametes can be described as the reproductive cells comprised of sex determining chromosomes. The chr...
Q: Describe and identify on which segment of the legs/limbs would you expect the ambulatorial, fossoria...
A: Insects (from the Latin insectum) are hexapod pancrustaceans belonging to the class Insecta. They ar...
Q: A 12-year-old boy is brought in by his mother with a 2-day history of fever and generalized weakness...
A: Peeiorbital erythema : skin redness Edema : swelling Opthalmoplegia : abnormal eye movement that o...
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding...
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for...
Q: In a three-point testcross the nonrecombinant progeny are A+B+ C+ and a b c. The double crossover pr...
A: Three point cross refers to usinh three genes to determine order and distance between genes. During ...
Q: Which of the following are repeating disaccharides of polysaccharides are often found in mucus and f...
A: Mucopolysaccharides are polysaccharides (long chains of sugars) commonly found in the mucus or the f...
Q: out 1 in 1 d as an pused club ation, but person wh probabilit
A: In some cases, clubfoot can be associated with other abnormalities of the skeleton that are present ...
Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...
A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...
Q: Functional Group Name Structural Diagram (draw all bonds) Found where in the body??? Hydroxyl H -N H...
A: Functional groups can be described as the groups of molecules that get linked to organic molecules a...
Q: I may have the answer but I'm not sure
A: A crop is a plant or plant product that may be produced and harvested for profit or for food. Crops ...
Q: How could you describe the process shown below? Farming reduces forest area Deforestation reduces ra...
A: By examining the above process it can be concluded that the terms Diverging process and Neutral proc...
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence. T...
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding r...
Q: While investigating the function of a specific growth factor receptor gene from humans, researchers ...
A: Growth factors work by engaging with certain cell surface receptors to control cellular proliferatio...
Q: What is adaptive immunity ?
A: Immunity is a complicated biological system with the ability to recognise and tolerate what belongs ...
Q: Please answer fast The phenotypes of organisms are products of genetics, environment, and gene x en...
A: Phenotype: it represent the physical properties of organism that can be observed. Phenotype includes...
Q: Kindly assist me with this one. I am really having a hard time writing an essay. Please. Thank you.
A: ANSWER: On 26 November 2021, WHO designated variant B.1.1.529 a variant of concern, following advice...
Q: a) Name and define the evolutionary processes that cause change in allele frequencies across generat...
A: a) There are five key mechanisms that cause a change in allele frequencies across generations. Muta...
Q: Trace the flow of hemolymph circulation in the insect circulatory system. Be able to explain how nor...
A: Insects, like all other arthropods, have an open circulatory system that differs from the closed cir...
Q: QUESTION 2 Which of these is a characteristic of adaptive immunity, but not innate immunity? O infla...
A: There is a battle for all living species to survive by conquering the complete harmful organism. The...
Q: One parent with the Achondroplasia phenotype and a normal parent have 2 children. Both children have...
A: Achondroplasia is a type of osteochondrodysplasia in which the cartilage at the ends of the limb bon...
Q: Please help Write a short sentence summary about taxonomy
A: Classification is very important in finding particular species of plant or animal in this vast varie...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: IgM vs IgG
A: Answer:
Q: The cuticle is a complex non-cellular layer secreted by the epidermis. It is the seat of complex pro...
A: 'Metamorphosis' is a natural mechanism in which creatures such as insects, amphibians, and a few aqu...
Q: If you were given the task of determining the approximate % solute of potato cells. You decide to se...
A: The process of osmosis is the transport of water or solute molecules across a semipermeable membrane...
Q: When doing science writing, it is okay to use direct quotes, phrases, or strings of words from anoth...
A: Science writing: it is a technical writing skills used by scientists and researchers to communicate ...
Q: You are told that the cells on a microscope slide are plant, animal, or bacterial. You look at them ...
A: Cell Cell is the basic functional unite of any organism.
Q: 2. which of these is the characteristic of prokaryotic cells? a. both of these b. do not posses true...
A: Phase contrast microscopy: The optical microscopy technique phase-contrast microscopy (PCM) translat...
Q: In German cockroaches, bulging eyes (bu) are recessive to normal eyes (bu+), and curved wings (cv) a...
A: Answer is e.bu cv+
Q: n Figure 4-19, what would be the RF between A/a andB/b in a cross in which purely by chance all meio...
A: ANSWER: Recombination frequency (θ) is the frequency with which a single chromosomal crossover will...
Q: Please answer in detailed explanation about these animal cloning questions a. What is animal clonin...
A: The term cloning refers to number of different processes that leads to production of genetically ide...
Q: он он GalNAC OH OH Gal но Он он CH,CONH B(1-) Gal a(13) a(12) O B(1-) H,C- но α(12) но L-Fuc H3C- A ...
A: In ABO system, there are four common blood groups are present; O, A, B, and AB. The blood groups are...
Q: Question:- How is the assembly of an antibody different than traditional forms of alternate splicing...
A: Introduction: The B lymphocytes, which are antigenically activated, undergo blast transformation to ...
Q: Achondroplasia is a hereditary condition caused by a dominant allele in humans (dominant allele A). ...
A: Achondroplasia Achondroplasia is a form of dwarfism in which ossification does not occur properly. ...
Q: answer the following question with in depth detail on habitat, lifestyles, and global distribution o...
A: Protists are eukaryotic organisms, they belong to the domain Eukaryota/Eukarya. Eukaryote organisms ...
Q: In normal tissues, which phase do cells capable of dividing spend most of their time in? Briefly de...
A: Introduction: Life is based on the cell cycle and cell division. Cell cycle and cell division are r...
Q: What are the factors which need to be considered in the selection of culture vessel?
A: Culture vessels:- Culture vessels provide a contamination barrier to protect the cultures from the e...
Q: Describe Brownian motion. What causes it? How does one differentiate between Brownian motion, water ...
A: Brownian motion or movement is that the uncontrolled movement of particles or zigzag pattern of move...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Question 39 Which antibody rises in this graph. PRIMARY IMMUNE RESPONSE Antibody concentration First antigen 1 exposure 4. Time (weeks) O IgE IgG O IgA IgD O IgM Antibody concentration In plasmaQuestion 10 of 14 Which of the following are true about MHC class I and MHC class II peptide loading? Select all that apply. MHC class I peptide loading occurs in four steps. Peptide loading of class I molecules generated from intracellular proteins occurs in the endoplasmic reticulum. ⒸMHC class II molecules are loaded before they are part of a vesicle capable of fusing with a phagolysosome. Peptide loading of class II molecules occurs later in the secretory pathway than that of MHC class I molecules.Question 18 sponse. Interferons are produced by O all healthy cells to prevent viral infection. O virus infected cells. O bacterial infected cells. O all healthy cells to prevent bacterial infection.
- Class I major histocompatibility complex molecules are found on O all anucleated cells. O antigen-presenting O all nucleated O None of the choices are correct. QUESTION 67 Important characteristics of antimicrobic drugs include O readily delivered to the site of infection. O high toxicity against microbial cells. O remains active in body tissues and fluids. do not cause serious side effects in humans. O All of these choices are correct. QUESTION 68 Antibodies O can bind to an immunogen. O are part of the nonspecific immune response. O can target the immunogen for destruction. O both can bind to an immunogen and can target the immunogen for destruction. O both can bind to an immunogen and are part of the nonspecific immune response.Question 9 of 14 Which of the following acts as a signal for the dendritic cell to begin cross-presentation? Presence of self-reactive CD4 T cells O Expression of endoplasmic reticulum (ER) chaperones calnexin and calreticulin O Phagocytosis and processing of extracellular antigens O Cytokine release following the activation of engaged CD4 T cells Question 10 of 14 Which of the following are true about MHC class I and MHC class II peptide loading? Select all that apply. MHC class I peptide loading occurs in four steps. Peptide loading of class I molecules generated from intracellular proteins occurs in the endoplasmic reticulum. MHC class Il molecules are loaded before they are part of a vesicle capable of fusing with a phagolysosome. Peptide loading of class Il molecules occurs later in the secretory pathway than that of MHC class I molecules.Question 60 60. Macrophages have surface receptors for all of the following EXCEPT some antibodies complement O capsular polysaccharides O Fc of IgG
- Question 59 59. Host Defenses. Which part of IgG will bind to antigen? Fab O Fc O "tail" of light chain "tail" of heavy chainO attack Question 27 What type of molecule signals to the brain, causing fever? O histamine antimicrobial peptide O interferon O pyrogenDifferent MHC I molecules between donor and recipient cells can lead to rejection of a transplanted organ or tissue. Suggest a reason for this.
- Question 22 Which is described as the faster response to infection, when one is immune? O primary response secondary response O autoimmune response O tertiary responseQUESTION 3 Immunological memory explains which of the following? O The ability of a helper T cell to activate B cells The human body's ability to distinguish self from non-self O The observation that someone who had recovered from the plague could safely care for those who are newly diseased O The observation that some strains of the pathogen that causes Dengue fever casue more severe disease than othersQuestion 1 Nursing. Innate lymphoid cells reside primarily in tissues such as the lungs, the lining of the gastrointestinal tract, and the skin, because these sites represent the major routes of entry of pathogens into the body. Several different subsets of innate lymphoid cells exist, and each is specialized to respond to a category of pathogen (e.g., viruses, extracellular bacteria, helminthic parasites, etc). a) True b) False