Q: Identify one Filipino scientist, Research on his contributions in the field of science, make a brief…
A: A biologist is a scientist who does biological study. Whether that's a single cell, a multicellular…
Q: Nascent form of the mRNA A. undergoes splicing only after capping B. is also called hnRNA C. is…
A:
Q: You live in a community with cell sites (or cellular-based stations). You ther thinks that this…
A: INTRODUCTION Cell sites or cellular-based stations are defined as a set of equipment that is needed…
Q: Describe the different potentials for regeneration of the three types of adult muscle after injury
A: Muscle tissue is made up of cells that have been differentiated in order to make the best use of a…
Q: What is the final electron acceptor for aerobic organisms? What does this mean?
A: Aerobic respiration needs oxygen. It is the release of large amount of energy in cells by breakdown…
Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI. Be sure to…
A: Answer
Q: Explain the single molecule of single-stranded DNA ?
A: DNA is the genetic substance which contains the genetic code of living things. The terms DNA and RNA…
Q: Identify the major mechanical and chemical defenses that protect internal tissues from microbial…
A: Natural barriers comprise the skin, mucous membranes, tears, earwax, mucus, and stomach…
Q: Eukaryotic rRNA genes are transcribed and processed in the Termination of bacterial transcription…
A: Note-Kindly repost the other questions. Thank you!!!
Q: When KO techniques was developed ?
A: The full form of KO is knock out and refers to gene knock out which means the gene that is knocked…
Q: Which microbiology test measures the use of LACTOSE? What color is positive in each?
A: Lactose is a naturally occurring sugar present in dairy products such as butter and desserts.…
Q: Replication of DNA requires a primer to initiate DNA synthesis because DNA polymerase can add new…
A: DNA replication is the process by which new DNA is produced from the old DNA in the…
Q: the healthcare concerns, infections, and nosocomial infections discussed for genera Staphylococcus?
A: Healthcare concerns, infections, and nosocomial infections discussed for genera Staphylococcus
Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…
A: The "nervous system", also known as the neural system, is a complicated network of neurons that are…
Q: what steps will be appropriate if the cavity has only 0.5mm of remaining dentin before entering the…
A: Dentin is the part of the tooth that is beneath the enamel and cementum. It contains microscopic…
Q: What are the possible genotypes of the offspring if you cross a brown cow and a black cow? Black cow…
A: Here C is the dominant allele for black color and c is the recessive allele for white colour.…
Q: 5. Small interfering RNAS, microRNAS and Piwi-interacting RNAS are all classes of small RNA…
A: RNA can be defined as a nucleic acid present in all living cells. It is similar to DNA, but differs…
Q: Explain the key to the Sanger technique ?
A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…
Q: Outline the events in the innate and adaptive immune responses, from when a pathogen invades to…
A: Introduction Immunity: it is the property/capability of our system to fight against the harmful…
Q: Design a laboratory protocol to develop a monoclonal or polyclonal antibody against a protein of…
A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…
Q: The annual flu shot is composed of either live attenuated influenza virus or influenza subunits (the…
A: The shots of flu can be given in several forms, such as: Needle-free vaccine. Nasal spray. High…
Q: Which of the following statements about ribosomes is correct? * a. the number of ribosomes in a…
A: Ribosomes are the most important cell organel composed of the RNA and proteins that convert genetic…
Q: A death from trauma to the body, overall unknown cause of death, and/or no doctors visits within 30…
A: Questionable death death is suspicious if it is unexpected and its circumstances or cause are…
Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…
Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the TRNA…
A: Answer :- Option (D) is correct. - Addition of CCA at the 5'end of the tRNA for binding with amino…
Q: differentiate founder effect from bottleneck effect
A:
Q: The Theory of Use and Disuse suggests that an organism’s body part may develop or disappear…
A: The evolution of organisms depends on several factors. The study of evolution mainly based on…
Q: Make a simplified schematic representation of the connective tissue cell lineage derived from…
A: The connective tissue cell lineage derived from hematopoietic stem cells and their functions.
Q: The genes that codes for the creation of certain blood groups are located on chromo- some "Xp22.3",…
A: Blood Inheritance Our blood type, like our eye or hair colour, is inherited from our parents. Each…
Q: Which of the following enzymes do not require a DNA template for nucleotide synthesis? *
A: DNA template is a DNA strand which is copied in to a complementary strand of DNA. According to the…
Q: In the US, many farmers regularly use the herbicide glyphosate to keep their fields free from weeds.…
A: Weeds are unwanted plants that grow in fields of particular crops.
Q: How does the concept of a stem cell differ between animal and plant systems?
A: A major difference that lies between plant stem cells as well as animal stem cells is that: plant…
Q: My Diagnosis for Pati Sex: Chromosomal Disorder Justification:
A: Chromosomes are the parts of your cells that contain your genes. Genes are parts of DNA passed down…
Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: how does planting of native trees support biodiversity and ecological stability?
A: In 1985, the word "biodiversity" was coined. It is essential in both natural and manmade ecosystems.…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: Ammonia concentrations are very low. Using structural formulac, diagram vert one molecule of…
A: Introduction Ammonia production occurs in all tissues of the body during the metabolism of a variety…
Q: O GCATGCT O ATGCATC O TCGTACG O CTACGTA
A: Maxam-Gilbert sequencing was initially more popular, in the end, Sanger sequencing won thanks to its…
Q: Drosophila melanogaster, the common fruit fly, is a model organism due to the similar relationship…
A: Given that, Researchers have discovered a new trait of fruit fly: blue eyes. A cross has made…
Q: a thymine dimer formed after UV radiation would be best described as a base substitution a base…
A: Mutation is the change in DNA sequence. Mutations can occur due to exposure to ionising radiation or…
Q: The species of the Galápagos Islands (a) are similar to those on other islands at the same latitude…
A: Scientists believe that all continents existed as a single landmass millions of years ago. Later, as…
Q: Explain the variation in diameter of skeletal muscle fibers and what type of muscle tissue undergoes…
A: Introduction Muscle fibers consist of elongated cells or a single muscle cell from 0.02 to 0.08 mm…
Q: Are there any safety concerns with teaching a cat in this way?
A: Learning is defined as any relatively permanent change in behaviour that occurs as a result of…
Q: Define about dideoxynucleotides (abbreviated ddNTPs) ?
A: The genome of an organism is defined as the entire genetic information that is passed down from…
Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?
A: Cell cycle progression is tightly controlled by cyclins and cyclin-dependent kinases (CDKs), the…
Q: According to evolutionists, which is the best test to show the relatedness of two organisms?
A: Evolution is the change in the characteristics of a species over several generations and relies on…
Q: Asymmetric cell division often relies on cytoskeletal elements to generate or maintain the…
A: Introduction A parent cell divides into two or more daughter cells in the process of cell division.…
Q: Describe the trend/pattern in the frequency of M as the population undergoes the following:
A: Key points: Microevolution is a change in the frequency of gene variants, alleles, in a…
Q: Analysis of DNA sequences for a particular locus among individuals within a population provides…
A: The order of the four basic building units that make up the DNA molecule - known as "bases" - is…
Q: Name the guidelines for naming of organisms?
A: There are numerous organism living on the surface of earth . Learning of these organisms is really…
Step by step
Solved in 2 steps with 2 images
- Place each charge form of alanine under the pH condition where it would be the predominant form. The pK₁ values for the carboxyl group and amino group of alanine are approximately 2.3 and 9.7, respectively. pH 11 H | H₂C-C-COO NH₂ Does not occur in significant amounts at any pHThe peptide aspartyl-glutamyl-leucyl-threonyl-alanine, shown in the sketch drawing window, has several ionizable groups. Adjust the charges to show the molecule as it would exist at pH 5.00. Use the pk values in the table below. pK, Values for Ionizable Groups of Amino Acids. Amino Acid pA, of a-COOH pA, of e-NH, pA, of Side Chain Isoelectric Point (pI) Alanine 235 9.87 6.11 Arginine 2.01 9.04 12.48 10.76 Asparagine 2.02 8.80 5.41 Aspartic acid 210 9.82 3.86 298 Cysteine 2.05 10.25 8.00 5.02 Glutzmic acid 2.10 9.47 4.07 3.08 Glutamine 217 9.13 5.65 Glycine 235 9.78 6.06 Histidine 7.11 9.18 6.10 7.64 Isoleucine 232 9.76 6.04 Leucine 233 9.74 6.04 Lysine 218 8.95 10.53 9.74 Methionine 2 28 9.21 5.74 Phenylalanine 2 58 9.24 5.91 Proline 2.00 10.60 6.30 Serine 221 9.15 5.68 Threonine 2.09 9.10 5.60 Trуptophan 238 9.39 5.88 Tyrosine 2 20 9.11 10.07 5.63 Valine 2 29 9.72 6.00 • Use the wedge hash bond tools to indicate stereochemistry where it exists. • If a group is 2chiral, do not use…Draw two different possible hydrogen-bonding interactions between two molecules of formamide (HCONH2). Clearly label the hydrogen-bond donor and acceptor atoms. Which of these two possible hydrogen-bonding interactions is more likely to occur? (Hint: Consider resonance structures for formamide.)
- Using condensed structures, supply an outline of the mechanism for the formation of Gly-Gly in the human body. (Hint: It is not a simple condensation reaction).Given the following information about amino acid tyrosine answer questions 1 & 2: A. O H HO OH HO HO рказ 10.1 H NH₂ CH₂OH A. NH3 С. НО 1. Which of the above forms of tyrosine will be predominant in a solution with pH 9.5? 2. Which of the above forms of tyrosine is a cation? Answers to Questions 3 & 4 should be selected from the following choices: CH₂OH Holl O OH B. NH₂ pka2 9.01 conj acid OH В. НО "OH D. HO HO H OH pka1 2.2 O H -OH CH₂OH C. NH3 HO NH₂ O HO OH D. 3. Which of the monosaccharides above is a non-reducing sugar? 4. Which of the monosaccharides above is an aldotetrose? 5. What is the main functional group in a protein? ||||OHRefer to the following titration curve below: 13 12 11 10 9 7 6 5 4 3 4 6 8 10 12 14 16 18 20 22 24 26 28 30 Volume of Titrant / mL - Unknown Acid 0.10 mol/L - titrant = NaOH 0.1 mol/L At ph 10.0, which form of histidine is most abundant? His2+ His- His° His+
- What is the optimum pH to separate a mixture of lysine, arginine, andcysteine using electrophoresis? Draw the structures of the three amino acidsin the protonation state that would predominate at the pH you have chosen.(as shown) For each amino acid, indicate the net charge at the chosen pH as well as the direction of migration and relative mobility in the electric field.Draw the Ala-Ser-Leu-Asp polypeptide (perspective formula) showing the fully extended backbone geometry (all angles +/- 180°). Include correct stereochemistry for L-amino acids. Label all bond rotations representing the angles at each residueMake use of the table below in answering the questions asked: Amino acid pK₁ pK₂ pK, Isoleucine 2.32 9.76 Leucine 2.32 9.74 Lysine 2.16 9.06 10.54 Tyrosine 2.20 9.21 10.46 I 1. Make sure to answer in two decimal places. What is the pl of the tripeptide ILY? 2. At pH 9.00, at which electrode will the ILY tripeptide be moving to? A. Anode B. Cathode C. The tripeptide will not move to either electrodes Make sure to show a solution or explanation for the answer.
- Phosphoproteins are formed when a phosphate group is esterified to an -OH group of a Ser, Thr, or Tyr side chain. At typical cellular pH values, this phosphate group bears two negative charges (-OPO32-). Compare this side-chain modification to the 20 side chains of the common amino acids found in proteins and comment on the novel properties that it introduces into side-chain possibilities.Draw the structural form of valine that predominates in solution at each of the following ph values: a. ph<pi ; b. pl ; c. ph>pi pk values: pk 1=2.2 ; pk2 = 9.7 Do also for asp (1.88, 9.60, 3.65) and lys (2.88, 8.95, 10.53)Consider an amino acid (A) with no ionizable side chains, and call the three species involved in the acid/base equilibria H2A+, HA, and A- (see scheme below). Assume that pKa(1) = 2.0 and that pKa(2) = 9.0. Suppose that the total concentration of the amino acid is 1.0 mM. Report to two significant digits. pH [H2A+] (mM) [HA] (mM) [A-] (mM) 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 9.0 10.0 11.0 12.0