a) What is the sequence of the copy and the template strands? b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy?
Q: What is the end replication problem?
A: The genes are formed by the Deoxyribonucleic acid (DNA) of an organism. These genes code all of the…
Q: Is there any situation in which DNA is made based on a RNA template? What is the enzyme involved?
A: ANSWER;- The cycle in which DNA is synthesized having as a layout an RNA chain is called reverse…
Q: If you had the RNA sequence below: 5' UUUGGAG3 and you were going to make a piece of DNA that would…
A: Uracil is the unique base in RNA, whereas in DNA it is thymine.. The strands runs antiparallel; one…
Q: What is meant by a primer, and why are primers necessary for DNA replication?
A: Primers are short DNA or RNA sequences complementary to the existing DNA strands. Without a primer a…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: INTRODUCTION: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: What is B-form DNA?
A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…
Q: What is the difference between B-DNA and Z-DNA?
A: DNA is the hereditary or genetic material present in most of the living organisms. It is majorly…
Q: Why is primase required for replication?
A: The process by which a DNA molecule makes its identical copies is known as DNA replication. It takes…
Q: What is the sequence of the DNA template strand from which each of the following mRNA strands was…
A: As we know that the DNA carries the information, which is translated into the mRNA and transcribed…
Q: How is it possible to generate so many products from a DNA that is able to fit inside the nucleus of…
A: DNA is the chemical name for the organic chemical that carries genetic information and contains…
Q: What is Strand ligation?
A: Ligation is the process of joining of two nucleic acid fragments through the action of an enzyme. It…
Q: Label the 5' and 3' end of each nucleotide and approximate where the start point (+1) would be on…
A: The process shown here is called transcription. In this process a molecule of mRNA is synthesized…
Q: What is a template strand or antisense strand?
A: Transcription is the way toward transforming a portion of DNA into RNA. The fragments of DNA…
Q: Why are proteases added while isolating the DNA?
A: Proteases are a group of enzymes which break the proteins into peptides and amino acids.
Q: Why is DNA gyrase necessary for replication?
A: DNA gyrase is an enzyme of class topoisomerase and subclass of topoisomerase type II. DNA…
Q: 2)For each item in the following table, decide whether it is related or involved in transcription,…
A: DNA is better represented by the central dogma of biology, which is transcribed to RNA, which is…
Q: Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the…
A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…
Q: Which strand of DNA is the template strand, and which is the informational strand?
A: Deoxyribonucleic acid (DNA) was a molecule which was composed of polynucleotide chain and it was…
Q: Does Z-DNA have major and minor grooves? Explain.
A: Answer
Q: During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following…
A: Replication is a biochemical process by which the DNA is synthesized on itself. It is mode by which…
Q: The sequence below shows the ends of one strand of a linear chromosome, with slashes representing…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: What is the difference between a template strand and adaughter strand of DNA?
A: DNA replication is a process that involves the formation of a new identical DNA strand from an…
Q: What is the difference between the template strand and the nontemplate strand?
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGC-3', which of the following…
A: Introduction : DNA or Deoxyribonucleic acid is the genetic material found in most living organisms.…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following…
A: The nitrogenous bases of two polynucleotides in a DNA molecule are linked through hydrogen bonds…
Q: What is an Okazaki fragment? In which strand of replicating DNA are Okazaki fragments found? Based…
A: DNA (Deoxyribonucleic acid) is the genetic material, which gets copied during cell division. The…
Q: In a double-stranded, B-form DNA, how many nucleotide bases can be found in 3 turns of the double…
A: Watson and Crick first described the structure of the DNA double helix in 1953 using X-ray…
Q: If a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?
A: Different macromolecules are present in the body, and they include carbohydrates, proteins, lipids,…
Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…
A: A complementary strand of DNA is constructed based on base complementarity. Complementarity is…
Q: What would be the amino acid sequence coded for by the template strand of the DNA molecule above?
A: The complementary strand or coding strands codes for amino acid in protein synthesis. The…
Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.
A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…
Q: Which statement is TRUE regarding the DNA ligase mechanism?
A: DNA ligases DNA ligases are the enzymes that are responsible for joining the two strands of DNA by…
Q: What is the difference between semi-conservative replication and dispersive replication?
A: DNA The DNA or deoxyribonucleic acid is made up of four nucleotide sequence adenine, guanine,…
Q: explain the term semiconservative replication?
A: Numerous trials were led to decide how DNA replicates. Basically, the semiconservative model was…
Q: What is the function of the sliding clamp at a replication fork?
A: Replication is a process to produce daughter DNA from parent DNA. Sliding clamp is a ring shaped…
Q: As the strands are synthesized in replication, which of the following is true?
A: The process of in which DNA molecule produce exact copy or replica of itself is known as the…
Q: Why is a clamp loader necessary in replication?
A: Clamp loader was identified as DNA polymerase processivity factors. Clamps not only increase the…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…
Q: Which DNA fragment is the smallest? *
A: Introduction :- Gel electrophoresis is a technique used to separate DNA fragments according to…
Q: If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the…
A: In order to make the complementary strand we have to look on following things:- DNA → DNA adenine →…
Q: What is RNA primer?
A: The nucleic acid is a nucleotides chain that stores genetic information. It forms RNA and DNA that…
Q: Why is it incorrect to suggest that DNA duplicates itself?
A: DNA replication is copying a double-stranded DNA molecule to make two identical DNA molecules.…
Q: What is the difference in DNA replicatoin on the leading strand versus the lagging strand?
A: DNA replication is a semi-discontinuous process as one strand is synthesized continuously whereas…
Q: What are template DNA. With example?
A: DNA is Deoxyribonucleic acid. It is a hereditary material which transfers from the parents to the…
Q: If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?
A: A nucleotide is a bio molecule that consist of a nitrogenous base, a pentose sugar (deoxyribose in…
Q: What is linker DNA?
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: If the rate of replication in a particular prokaryote is 900 nucleotides per second, how long would…
A: DNA replication a process by which DNA makes copies of itself and this process requires lots of…
Q: Considering prokaryotes, what is the enzyme that synthesizes RNA primers needed to start…
A: DNA replication means the synthesis of daughter DNA strands using the parental strands as a…
Step by step
Solved in 4 steps
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'A Sanger product of the sequencing of a template DNA is presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNA
- There are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).Is there any situation in which DNA is made based on a RNA template? What is the enzyme involved?Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.
- What is generated from the replication of DNA ? what method is used ? Describe the process. What are Okazaki fragments? What enzymes are used ?Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many total hydrogen bonds are in this double strand of DNA? Template : P- AGACTTG-OH New strand :Kornberg and his colleagues incubated soluble extracts of E. coli with a mixture of dATP, dTTP, dGTP, and dCTP, all labeled with 32P in the alpha-phosphate group. After a time, the incubation mixture was treated with trichloroacetic acid, which precipitates the DNA but not the nucleotide precursors. The precipitate was collected, and the extent of precursor incorporation into DNA was determined from the amount of radioactivity present in the precipitate. (a) If any one of the four nucleotide precursors were omitted from the incubation mixture, would radioactivity be found in the precipitate? Explain within 2 sentences. (2) (b) Would 32P be incorporated into the DNA if only dTTP were labeled? Explain within 2 sentences. (2) (c) Would radioactivity be found in the precipitate if 32P labeled the β or γ phosphate rather than the α phosphate of the deoxyribonucleotides? Explain within 2 sentences. (2)
- For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’The following DNAs were incubated with E. coli DNA Polymerase I and dNTPs. Write the products expected in each reaction. Indicate the activity used in each reaction.Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP), to all of the reaction vials All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; together with one of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP), one for each lane, in each vial. One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane, together with all of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP) in each vial One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane