A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes the result of the mutation when the corresponding mRNA sequence is translated?
Q: Messenger RNA is formed by translation of a gene on the DNA template strand.True or false?
A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…
Q: Which enzymes are involved in protein translation? There are multiple answers. Helicase DNA…
A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…
Q: Which of the following components is not involved during the formation of the replication fork? a.…
A: DNA REPLICATION It is the process of formation of new DNA from the existing DNA. It is essential for…
Q: The enzyme responsible for adding new nucleotides to a growing DNA chain during DNA replication is…
A: DNA is the nucleic acid that stores genetic information.
Q: . How does the double helix structure of DNA support itsrole in encoding the genome?a. The…
A: Deoxyribonucleic acid (DNA) is the molecule that is inherited from the preceding generations to the…
Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…
A:
Q: List the steps involved in the replication of DNA.
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is…
A: The genetic code is a triplet code called a codon. The indicated amino acid can be specified by more…
Q: Which of the following processes is a part of protein synthesis and is NOT affected by a silent…
A: Introduction DNA is a self replicating molecule. During DNA replication each strand of DNA acts as a…
Q: What is the sequence of the DNA template strand from which each of the following mRNA strands was…
A: As we know that the DNA carries the information, which is translated into the mRNA and transcribed…
Q: What determines the sequence of nucleotides in the mRNA strand?
A: The process of converting the genetic information in the mRNA or messenger RNA into a protein is…
Q: a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What…
A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…
Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…
A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…
Q: Which of the following processes occurs in the nucleus and forms acomplementary copy of one strand…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: DNA is synthesized through a process known as ....... translation semiconservative…
A: At the point when a cell divides, it is vital that every daughter cell gets an indistinguishable…
Q: DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA…
A: The replication is the process of new DNA synthesis from the old DNA. The transcription is the…
Q: If a cell were damaged, & DNA ligase could no longer be produced, how would replication be affected?
A: Each strand of DNA participates in DNA synthesis due to its double helix structure. DNA synthesis is…
Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus? In other words,…
A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…
Q: What enzyme initiates DNA replication? a. ligase b. helicase O c. primase d. gyrase
A: Which enzymes initiates the DNA replication? DNA replication is bidirectional and originates at a…
Q: The following statements are correct EXCEPT: A) Information in the DNA is transcribed int mRNA and…
A: DNA is a genetic material which is safely stored inside the nucleus of the cell . It is ladder like…
Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…
A: In order for a gene to be converted into a functional protein, two processes must take place namely…
Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…
A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…
Q: If the DNA strand has nitrogenous base sequence ATTGCC, the mRNA will have?
A: The transcription is a process of conversion of DNA to mRNA using RNA polymerase enzymes which…
Q: During elongation, which of the following is NOT required in the continuous replication of DNA? O…
A: DNA replication is the process of producing daughter DNA from the parental DNA.
Q: Describe the DNA replication process, including its initiation and the events that occur at the…
A: Watson and Crick discovered that DNA was a two-stranded double helix which provided an idea of how…
Q: What would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?
A: The process of transcription starts as the DNA of a gene serves as a template for complementary…
Q: tabulate 2 differences between DNA replication, the process of trancsription and translation…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Why is a mutation of a base in a DNA sequence much more serious than a mutation in a transcribed…
A: Replication is considered as the process, during which DNA is replicated into DNA, which is after…
Q: Name differences between replication and transcription.
A: Answer 1: Replication- Replication is the process of producing two identical copies of DNA from the…
Q: Just prior to DNA replication the cytosine in the sequence GTTCATTG is deaminated and it is not…
A: The deamination means removal of the amino group (-NH2) from a particular molecule. In the cell…
Q: Using the following DNA sequence what would be the complementary DNA made during replication? TAC…
A: Complementary DNA is synthesized from a mature mRNA strand and it lacks both promoters and introns.…
Q: A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this,…
A: DNA refers to deoxyribonucleic acid. It is the genetic material of almost all organisms, except a…
Q: When DNA replicates, each resulting DNA molecule retains half of the original DNA strand. Because of…
A: In DNA replication a copy of the existing DNA molecule is formed.
Q: new DNA molecule is precisely synthesized during the following EXCEPT? A.Trasformation B.…
A: Nucleic acid is a long chainlike molecule composed of nucleotides found in cells of all living…
Q: Given the following DNA strand, which of the following is its complementary MRNA? G GACIGATT"…
A: Transcription and translation are two processes of gene expression. The process of the formation of…
Q: During DNA replication,why is it that the entire molecules does not open in one go?
A: DNA replication is the process of making two identical copies of DNA (deoxyribonucleic acid) from…
Q: Following transcription, the RNA has a complementary sequence of which of the following? Question 9…
A: The process of copying of DNA segment onto an RNA using enzymes and nucleotides is called as…
Q: Which of the following statements about the processes of the central dogma is/are incorrect? I.…
A:
Q: replication, transcription, and translation
A: Central Dogma of Molecular biology: It is defined as the process of flow of genetic information in…
Q: why is DNA replication is important to humans?
A: In DNA replication, a double-stranded DNA molecule is replicated (by a suite of different proteins)…
Q: Describe the role of DNA ligase in the replication process
A: DNA ligase is an enzyme that joins two segments of DNA. The fragments of DNA are joined together by…
Q: At which point during DNA replication is genetic lost from the telomeres? Enzymatic action of…
A: Replication is the process of making two identical DNA molecules from a double-stranded DNA…
Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…
A: DNA are double helical structures that contains genetic information, which is responsible for almost…
Q: Why is the shape of an enzyme important for its functioning? When does replication occur? Does the…
A: Enzyme are made up of proteins they catalyse the reaction and increase the speed of the reaction by…
Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…
A: Transcription of DNA into mRNA and translation of mRNA into protein is known as the central dogma of…
Step by step
Solved in 3 steps
- mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GUse the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First Position
- Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion SubstitutionUse the codon chart to translate the following MRNA transcript into a protein. Please format your answer in this way .....*. Seond letter UUU UUC UCU UCC UCA UAU UAC U Cys Phe UGU UGC UAA Stop UGA Stop A UAG Stop UGG TrpG Tyr C Ser UUA Leu UUG UCG CUU CCU CGU CGC CAU His CUC CAC C. CỦA CUG Leu Pro Arg CCA CGA CAA CAG Gin CGG AAU AGU AGC AUU ACU Asn Ser AUC lle ACC AAC Thr AUA AUG Met ACG ACA AAA AGA A. Arg AAG Lys AGG GCU GCC GCA GUU GAU GGU GGC Asp GUC Val GUA GAC GAA GAG Ala Gly GGA GGG Glu GUG GCG AUGCCUGGACAUUUUCAAGUAUAA HTML Editor BIUA - A - I E Z I 1 I x x, E E Paragraph First letter Third letterIf the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
- The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- Gw/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
- Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterUse a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, Glycine