A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5 kg of SO2 per day. (1) If the functional unit is 1 kWh of electricity, please relate the emissions to FU. (2) What are the emissions for a plant generating 2000 kWh of electricity? (3) What if the functional unit is 1000 kWh? (4) What if the functional unit is 1000 MJ of energy? (5) What is the functional unit is 1kg of coal?
Q: 1. Explain what happens in the following stages A. S phase: B. Prophase: C. Anaphase: D.…
A: The question is asking for a detailed explanation of what happens during the S phase, Prophase,…
Q: In the alpha helix shown below, all carbonyl groups are pointing_ amino groups are pointing…
A: The secondary structure of a protein refers to the folded configuration of the polypeptide chain.…
Q: You find a vial of clear, unknown sample in the freezer of your lab. The easiest way to determine…
A: We have to find the easiest way to determine the presence of proteins in a sample vial.The given…
Q: 23. Calculate the free energy of hydrolysis ATP in a rat liver cell in which the ATP, ADP, and Pi…
A: The objective of this question is to calculate the free energy of hydrolysis of ATP in a rat liver…
Q: 4) Following is the structural formula of lycopene, a deep red compound that is partially…
A: ● Lycopene is a naturally occurring pigment belonging to the carotenoid family which is…
Q: pindle The cell above is in a) Meiosis 2 b) Meiosis 1 c) Mitosis ****
A: Given cell is in metaphase stage. It is a mitosis cell division.
Q: Genetics 8 Q4
A: The question is asking whether the process of meiosis, which is the division of a germ cell…
Q: Sketch graphs expected for the Product concentration Vs substrate concentration.
A: Enzymes can be defined as proteins that help to speed up the metabolism. They basically act as…
Q: Part 1. In dilute acid, hexoses exist in equilibrium with the corresponding 1,6-anhydrosugars. For…
A: One or more water molecules have been removed from sugars, which are known as hydro sugars. One…
Q: A potent inhibitor effectively inhibits an enzyme catalyzed reaction. What kind of a Ki value you…
A: An inhibitor is defined as a molecule that binds to an enzyme and decreases its activity whereas a…
Q: (5) Muscle and red blood cells produce lactate, which is then transported to the liver to support…
A: When glucose is available, oxygen is present and there is an energy demand; glucose is oxidised into…
Q: What is the effect of each of the 4 types of inhibitors on the initial rate of an enzyme catalyzed…
A: Inhibitors of enzyme catalyzed reactions are broadly classified into reversible and irreversible…
Q: Question 8 Listen In Labrador dogs, there are 2 genes that determine coat color. One gene has a…
A: The objective of this question is to determine the probability of a Labrador dog being black given…
Q: The Drug AZT is used to treat AIDS, This drug is a _____ Inhibitor/Activator of _____ a)…
A: HIV stands for human immunodeficiency virus. HIV destroys a type of white blood cells that help the…
Q: In the study by Amano et al. the authors developed a collection of RNA sequences that showed optimal…
A: Fibroblast growth factors (FGFs) are a family of signaling molecules crucial for various cellular…
Q: Use the scoring system described to calculate the alignment score for IPNIA A IG D V VAG P VKGIYA V…
A: The alignment score is the sum of individual matches when two or more DNA or protein sequences are…
Q: Question 7 Listen a= albino A= Non Albino b=blond B=Dark Hair c=straight hair C=Curly Hair d-deaf D=…
A: The objective of this question is to calculate the probability of an offspring inheriting specific…
Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…
A: The objective of the question is to identify the coding and template strands in the given DNA…
Q: The predicted thermodynamic yield for anaerobic oxidation of methane coupled to sulfate reduction is…
A: Comparing two Reverse Methanogenesis Mechanisms of Sulfate-Dependant Anaerobic Methane Oxidation…
Q: Which of the following is not a carbohydrate? a. C3H603 Ob. C50H100050 c. C6H806 d. C4H804
A: Definition of Carbohydrates: Carbohydrates are organic compounds made up of carbon, hydrogen, and…
Q: Calculate the standard free-energy change of the reaction catalyzed by the enzyme…
A: Standard free energy change () is the free energy change at standard conditions.Here;'R' is the…
Q: The conversion of pyruvate into acetyl CoA consists of three steps. Identify these three steps and…
A: The pyruvate dehydrogenase complex (PDHC) is an enzyme complex composed of 3 enzymes.Pyruvate…
Q: If someone's pH increases above 7.8, they die. How much would the % buffer have to shift from normal…
A: The usual pH range for blood is 7.35 to 7.45. The body's buffering systems, such as the phosphate…
Q: Propose structures for intermediates A and B in the scheme below. This three-step conversion is…
A: Citrate is isomerized to isocitrate in the citric acid cycle via dehydration and rehydration. These…
Q: Draw the following amino acids linked by peptide bonds: a. aspartate b. lysine c. cysteine d.…
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers or…
Q: Cellulose contains___ linkages that ___ be digested by animals. a β1--> 4 glycosidic ; canNOT b…
A: Cellulose is a polymer of units. It is used by plants and some microbes as a means of mechanical…
Q: 1. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: Fatty acids are organic compounds determined by a long hydrocarbon chain having a carboxylic group…
Q: For competitive inhibition: a. the value of Km decreases b. the value of Vmax decreases c. it is…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: Which factor contributes to the selectivity pore of the potassium channel from S. lividans? O…
A: S lividans stands for Streptomyces lividans. It is a gram positive & filamentous bacterium that…
Q: GQ5
A: The question is asking about the stage of cell division in which sister chromatids separate. Sister…
Q: You are sprinting around a track and at about the 200 meter mark you start to feel a burning…
A: Fermentation is defined as an anaerobic process in which even during absence of oxygen, energy can…
Q: Using the information given, determine the Kd for the binding of HABA to BSA. B= y-intercept (E…
A: Y=mx+b is the equation of a line that is not passing through the origin. In this equation, m is the…
Q: Question 4 Listen A gene known as H is epistatic to the ABO blood type genes. Based solely on this…
A: The question is asking us to determine which of the given options is possible based on the statement…
Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…
A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…
Q: 4. The interaction of Vitamin D3 with lipid membranes may be studied using different techniques. One…
A: A class of fat-soluble secosteroids is called vitamin D3 .Vitamin D3 is a kind of vitamin D that is…
Q: Macmillan Learning Consider the structure of methionine in its +1 charge state. H₂N- _ƒ_ƒ_„_€ O -OH…
A: Amino acids are the building blocks of proteins which consists primarily of two functional groups.…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…
A: The process of protein synthesis is also known as translation. The process of translation is…
Q: How many dissociable protons are present in Tris buffer? How did you come to this conclusion?…
A: Tris buffer is also known as tris(hydroxymethyl)aminomethane. It is an organic compound with the…
Q: What did experiments using porcelain filters prove? Select all answers that apply. Porcelain filters…
A: Porcelain filters were engineered in the late 19th century by scientists as bacteriological filters…
Q: (1) For 10 glycolytic reactions (1-10), refer to your textbook, answer the following questions in…
A: Glycolysis is a catabolic pathway that breaks down glucose into pyruvate molecules. This occurs in…
Q: Choose the correct structure for thiamine hydrochloride at pH 3. H3C H3C NH₂ NH₂ CI- A CI- с CH3 CH3…
A: The relationship between pH and pKa is described by the Henderson-Hasselbalch equation:pH = pKa +…
Q: Genetics Question 10
A: The question is asking about the sequence of events that occur during meiosis and the preceding…
Q: how does the protein porin cross the lipid bilayer in a cell membrane
A: The objective of this question is to understand the mechanism by which the protein porin crosses the…
Q: GQ7
A: The objective of the question is to identify the correct relationship between the two X chromosomes…
Q: Draw the structures of Allura Red and the reduced products formed when it had reacted with NADH
A: Allura red is synthetic food coloring, it is a red azo dye that is frequently used in various food…
Q: how to use valine in a 2 chemical equation involved in this experiment using the scheme below .
A: A method for separating and analyzing amino acids in a mixture is HPLC Ion Exchange Chromatography.…
Q: s) In two experiments carried out in a research lab, an enzyme reaction is run with and without an…
A: Enzymes are proteins that catalyze biochemical reactions. They contain an active site where the…
Q: What is the molecular weight of the molecule that gets eluted from the column at 10 ml?
A: The given graph shows a linear relationship between the elution volume (ml) on x axis and IgM…
Q: Tube # 2 3 4 6 5. THE EFFECT OF TEMPERATURE Temp. Abs. 0°C N/A 0°C 25°C 25°C 37°C 37°C 70°C 70°C 10…
A: Changes in temperature can affect the enzyme in different ways. When the temperature of the system…
Q: In the following scheme: HNH, IT H,C-C-C-Coo II H HO 1 O NH, 1 H₂C-C-C-COOⓇ H 2-Amino-3-ketobutyrate…
A: Metabolism consists of catabolism and anabolism. Catabolism refers to the breakdown of compound to…
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- To produce 1000 kJ of electrical energy, the turbine of a power plantconsumes 2860 kJ. What is the energy efficiency of the turbine ?according to the chart pie 1)what percentage of energy is produced by fossil fuel? 2)what percentage of energy is produced by energy technologies? 3) how much energy is produced by all alternative energy combined? U.S. energy consumption by energy source, 2017 Total 97.7 quadrillion British thermal units (Btu) Total = 11.0 quadrillion Btu geothermal 2 % solar 6% petroleum 37% - wind 21% biomass waste 4% biofuels 21% renewable energy 11% nuclear electric power 9% biomass 45% natural gas 29% wood 19% coal 14% hydroelectric 25%Environmentally conscious Susan has been told that a newelectric car will only generate 6 ounces of greenhouse gases (GHG) permile, but that a standard internal combustion car is double that at 12ounces per mile. However, the nature of electric cars is such that the new technology and electric batteries generate 30,000 lbs. of GHG to manu-facture and another 10,000 lbs. to recycle. A standard car generates only 14,000 lbs. of GHG to manufacture, and recycling with established tech-nology is only 1,000 lbs. Susan is interested in taking a systems approach that considers the life-cycle impact of her decision. How many miles mustshe drive the electric car for it to be the preferable decision in terms ofreducing greenhouse gases?
- For scenario 2, below write the following 1.the process that the sets of measurements represent. 2.suitable equations of the process. 3.the calculated rates and 4.the resulting units for the process as expressed by your calculation. Scenario 2 Time,0 minutes:7.13mg/L O2 Time,20 minutes:13.39mg/L O2 Algal biomass:2.3g fresh massIf a plant is removed from its natural environment and exposed to 100 percent CO2 composed of the radioisotope 14C, which of the following will not occur?what is The standard free energy change for the combined system that you wrote in the previous problem
- Approximately how many tons of carbon (C) does 2 tons of dry wood contain?A photobioreactor (PBR) system is used to sequester CO₂ from a small boiler operating at 20 kWth, fired with natural gas and with a capacity factor of 25%. Assuming that the microalgae can grow at 2 g/L-day over 365 days per year and utilize the emitted carbon, calculate the total reactor volume that is needed to sequester 100% of the CO₂ emissions per year. Briefly comment on your answer and potential problems of this CCS method.The chemical reaction equation for the conversion of ethanol (C2H5OH) to acetic acid (CH3COOH) is: C2H5OH + O2 → CH3COOH + H2OIn a vinegar production industry, acetic acid is produced from ethanol during the growth of the bacterium Acetobacter aceti, whose cellular composition is CH1,8O0,5N0,2. The biomass yield from substrate is 0.14 g/g, while the product yield also from substrate is 0.92 g/g. Ammonia is used as a nitrogen source. Based on this information, answer: (a) What is the oxygen demand for acetic acid production in this crop?(b) What are the cooling requirements of a bioreactor containing 3000 L of ethanol (ρ = 789 kg/m³), to be completely converted into acetic acid?
- What is the concentration of chlorophyll B if an absorbance of 1 is measured at 431nm in a cuvette with a pathlength of 1cm. (Chlorophyll B Extinction coefficient: 57.43 mM-1 cm-1)(a) Distinguish between photodissociation and photoionization.(b) Use the energy requirements of these two processesto explain why photodissociation of oxygen is moreimportant than photoionization of oxygen at altitudesbelow about 90 km.What is the optimal mix of fuels for use during a marathon?