1,000 bp- 700 bp. 500 bp 200 bp. 100 bp- Lane 12345678 6 8 Sample Molecular weight ruler Positive control DNA (+) PCR Sample (S) PCR Sample (C) PCR Sample (D1) PCR Sample (D2) PCR Sample (B/D3) Negative control (-) 1 2 3 4 5 6 7 8 I 1 I I
Q: How would most biologists and anthropologists explain the reasons behind why primates do specific…
A: Primate behavior is generally understood by scientists and anthropologists to be the consequence of…
Q: Compare the costs and benefits of being an endotherm, and describe strategies endotherms use to…
A: Endothermy, or warm-bloodedness, is a physiological attribute introduced in some animals like as…
Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…
A: The objective of the question is to determine the sensitivity and specificity of a urine test for…
Q: Gel Electrophoresis A. Why does DNA travel toward the positive electrode in the gel chamber? B. What…
A: Approach to finding a solution to the problem:1. Have a solid understanding of the fundamentals of…
Q: Microarrays a. must be preceded by a sothern blot b. compare gene expression levels across many…
A: Here's why the other options are incorrect:a. must be preceded by a southern blot: Southern blots…
Q: Which blood product is used in the treatment of DIC? Question 9 options: a)…
A: The question is asking about the appropriate blood product used in the treatment of Disseminated…
Q: 1.1 Compare the expression pattern of Lfng in one period of somitogenesis between the WT and DI13Pu…
A: In wild-type (WT) embryos during somitogenesis, Lfng expression is typically observed in a periodic…
Q: Choose all the items that catalyze the phosphodiester bond. - enhancer - promoter - activator…
A: The objective of the question is to identify the biological entities that can catalyze the formation…
Q: true or false if a restriction enzyme recognizes the restriction site, 5' AACGTT3', and the enzyme…
A: 1. Recognition Site of the Restriction Enzyme:The recognition site of a restriction enzyme is the…
Q: There is more diversity of major types of leukocytes associated with what type of immunity? innate…
A: Leukocytes, often known as white blood cells, are essential components of the immune system. They…
Q: The domestic dog belongs to the species Canis familiaris. The great dane, golden retriever, cocker…
A: Canis familiaris belong to the family Canidae and share evolutionary relationship with gray wolves,…
Q: The primary reason that Earth experiences seasons is because of the a) Coriolis effect b) Earth's…
A: Earth's seasons are a result of its axial tilt, which causes different parts of the Earth to receive…
Q: In order for a cell to receive and respond to a particular extracellular chemical signal, it must…
A: Ans:- Correct ans is receptor
Q: 8:20 ■■ LTE < Spring 2024 - Senior Comprehensives (... Question 6ɔ (ividitudtory) In the Lac operon,…
A: Detailed explanations for each question: Question 5: In the Lac operon, what happens when…
Q: Which of Aristotle’s four causes is a definition of the substance of which something is composed?…
A: The objective of the question is to identify which of Aristotle's four causes refers to the…
Q: 7:09 PM Wed Apr 10 Three strains of green-seeded lentil plants appear to have the same phenotype.…
A: Part C: It is suggested that one gene with two alleles (dominant and recessive) is segregating by…
Q: Identify the indicated microscope part from the following choices: ○ Stage O Coarse knob O Objective…
A: Also known as the eyepiece, the "Ocular lens" is another popular name for this component. When you…
Q: For which of the following transfusion candidates would CMV-negative blood be most likely indicated?…
A: The objective of the question is to identify the group of patients who would most likely require a…
Q: If 80% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 60…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: Discuss briefly the pharmaceutical applications of micelles?
A: Micelles are self-assembled structures formed by certain molecules called amphiphiles in a suitable…
Q: BC, a 25-year-old African American female, has presented to the emergency department at a local…
A: The objective of the question is to determine the Rh type of the patient BC based on the results of…
Q: GQ16
A: Refer to the solution
Q: What are noticeable characteristics of the Indri and how do their skelatons detail their locomotive…
A: The Indri, also known as the babakoto, is the largest living lemur species native to Madagascar.…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: b) Pink body color females:Expected number = Total number of flies * Probability of being pink= 120…
Q: BC, a 25-year-old African American female, has presented to the emergency department at a local…
A: The objective of the question is to determine the ABO blood type of the patient BC based on the…
Q: Myeloperoxidase staining activity decreases as cells mature. Question 1 options: True…
A: The question is asking whether the activity of myeloperoxidase, an enzyme found in neutrophils and…
Q: Rare forms of lymphoma include Question 7 options: A) Hodgkin and…
A: The question is asking to identify the rare forms of lymphoma from the given options.
Q: Which of the following is NOT an adaptation among plants to increase access to nitrogen?…
A: Mutualistic association with fungi that convert atmospheric nitrogen into a biologically available…
Q: Suppose species 1, 2, and 3 are endemic to a group of islands (such as the Galápagos) and are all…
A: In biology, it's imperative to know how distinctive species are related to each other so we will…
Q: The Christian doctrine of Jesus’ resurrection, and Philo Judaeus’ claim that a second birth is…
A: The question is asking to identify the mythology that shares a common theme with the Christian…
Q: 1.) why people living in poor neighborhoods have a more difficult time eating well and have higher…
A: Let's break down how the answer comprehensively addresses the question based on the reference,…
Q: Are there any major differences between new world monkey skulls and strepsirrhines skulls? Take into…
A: Approach to Solving the Question:To comprehensively address the question, it's important to approach…
Q: For a virus to transform a cell, which of the following events must occur: Group of answer choices…
A: The objective of the question is to identify the necessary events that must occur for a virus to…
Q: Urease: 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain the…
A: 1. Incubation ConditionsTemperature: The test is usually incubated at 35-37°C, which is the optimal…
Q: What is the common ancestor of the Galapagos finches? What are the thirteen Galapagos finches? What…
A: Delving deeper into each aspect related to the Galapagos finches: 1. Common Ancestor: The common…
Q: Define acidosis and alkalosis. Distinguish among respiratory and metabolic acidosis and alkalosis.
A: pH is the negative logarithm of H+ concentration in a solution. The pH range goes from 0 - 14. If…
Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…
A: The objective of the question is to determine the sensitivity and specificity of a urine test for…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: To determine the correct chromosomal condition for one daughter nucleus at telophase of mitosis, we…
Q: Explore the differences between positive inducible, positive repressible, negative inducible, and…
A: When an inducer molecule binds to a repressor protein, it undergoes a conformational shift that…
Q: GQ15
A: The objective of this question is to explain how not all mutations are harmful, using the example of…
Q: using the method for experiment below and the table conduct 1 graph of the different factors vs rate…
A: Here is a funnel graph of your data and method above:
Q: For Glycolysis what are steps of cellular respiration for both aerobic (oxygen present) and…
A: Aerobic respiration- The respiration is a fixed metabolic reaction that takes place in the presence…
Q: If you were educating expecting parents on pregnancy, labor and delivery, as well as the first year…
A: Prenatal Development:1. First Trimester (Weeks 1-12):• During the first trimester, the fertilized…
Q: Smudge cells are frequently seen in: Question 6 options: A) CLL.…
A: The objective of the question is to identify the type of leukemia in which smudge cells are…
Q: Answer the following questions about CRISPR below: A.What is a PAM sequence? B.How does the…
A: A. PAM Sequence:A PAM sequence, or Protospacer Adjacent Motif, is a specific DNA sequence that is…
Q: What is the significance of the complementarity of the two strands of DNA? It prevents mutations…
A: The question is asking about the importance of the complementarity of the two strands of DNA.…
Q: Genetics Q8
A: The objective of the question is to identify which region of the mRNA, when affected by triplet…
Q: Proto-oncogenes can change into oncogenes that cause cancer. Which of the following best explains…
A: Cancer is caused by abnormal cell growth causing the formation of tumors. Tumor is a mass of cells…
Q: What are the key behavioral characteristics of the indri? For example, preferred habitat, activity…
A: Indri indri are the arboreal lemur species. Indris are slender, long-limbed primates found in the…
Q: Papua New Guinea is known for its rich biodiversity and unique ecosystems.Write an essay exploring…
A: The objective of the question is to write an essay on the environmental conservation and…
Band, Band Size, and what bands corresponds?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…DNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at FC or at room temperature. Longer spins make it difficult to resuspend cells. 2 Resuspend pellet in 100pul GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200ul NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150ul potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…You are given a tube containing 275 ng of purified PCR product (DNA) that is 1262 bp long. How many picomoles of PCR product are in the tube? The average molecular weight of a deoxynucleotide monophosphate is 328 g/mol.
- In a PCR-based crime scene investigation, similar to the one presented in the lab module with Brother Y and Brother X, there is a sample of DNA from a crime scene that is likely to belong to the guilty party. Based on the gel photo below, which shows the results of an electrophoresis gel following PCR amplification at one locus of 5 DNA samples - one crime scene sample and 4 suspects - which suspects can be excluded from this investigation? [Keep in mind that it is not possible for a heterozygous person to leave only one allele at a crime scene. If any one allele does not match, then that suspect is eliminated.] Choose all that apply.A typical polymerase cycle reaction (PCR) program (Figure 3) followed as: HOLD 1 HOLD 3 HOLD 2 (30CYCLES) 95° C 94°C 72C 72° C 04:00 1:00 1:00 10:00 52.0° C 1:00 04° C 00 Figure 3 (i) Why is polymerase cycle reaction (PCR) repeated 30 times (Figure 3)? What are the differences between primers for PCR program, and primers for DNA replication process during S-phase? (ii) (iii) What are the FIVE (5) basic reagents used in PCR?You will be setting up your diagnostic digest on three plasmids, the ones you began with, pGFPuv and PHSG298 and your presumptive pHSG298-GFP. Complete the table below: Solution Stock Working Volume for one reaction Volume for Master Mix (3.5X) Cutsmart buffer 10X 1X Restriction enzyme(s) 1 µl uL Water UL UL 2 µl 25 pL DNA Total volume
- PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…Complete this Master Mix table for 8 DNA samples, a positive control, negative control, and an extra reaction for pipetting error. Show your work. Master Mix Conc. Of Total μL µL/Rxn (total per tube) Final Number of Stock Conc. Reactions needed for solution master mix PCR buffer 50X 1X Water DNTP mix 100 mM 200 µM MgCl2 Forward 24 mM 2.5 mM 2 μΜ 0.1 μΜ primer Reverse 2 μΜ 0.1 μΜ primer Taq polymerase DNA 5 U/uL 0.03 U/ µL 1 μL 60 μL Total volume of the entire reaction (µL)Polymerase chain reaction (PCR) is a technique that enables multiplication of specific DNA sample at minute amount to millions or billions of copies at a short time span. (i) (ii) Figure 1 indicates the chemicals added into the PCR reaction tube prior to the addition of thermostable DNA polymerase. Do you agree with the list? Justify your answer. DNA template Buffer (containing Tris-HCI, KCI, Mg2+) ddNTP Forward primer Reverse primer Figure 1 If TA cloning is planned to be carried out after amplification of the gene, which thermostable DNA polymerase will you select and the reason for your selection?
- PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCOȚAGCTATATOCTATCOTGACOTATCOGCOCATTAAȚCGGGATCGAT 3 3' TGGCATCGATATACGATAGCACTGCATAGCCGCGTAATTAGCCCTAGCTẢ 5 50 5' AGCTCGCTAGCAGGAGAGATATCGCTCATAGCTCCGATCGATGCCGCTAA 3 100 3' TCGAGCGATCGTCCICTCTATAGCGAGTAICGAGGCTAGCTACGGCGATİ 5' 5' TATAGCTCTCTGCGGATATÇGCATẠTACCAAGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACGCCTATAGCGTATATGGÍTCCGGGATGČATACATCGAŤ 5 5' TGCGȚATATÇGGAGAGTCCTGGATAT GGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCATATAGCCTCICAGGACCTATACCTCGAACÍGACGICTCTCGAGCİ 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 250 3' ATACGCGAATCCGGCATATACGAACCCCTITCGAĞATACATACG ẢTACAČ 5' 5' TGCATOTGCTATOCAACGTTC GGATTGCGȚAGCAGTAATAGCGCCGATTO 3' 300 3'…Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which picture shows the correct 4 reactions after separation of the sequencing reaction by gel electrophoresis? Template: Primer: 5'-ATCGCTTACCATTAG-3' 5'-CTAAT-3' ddA ddC ddG ddT ddA ddC ddG ddT = D ddA ddC ddG ddT A ddA ddC ddG ddT — B Cresearcher runs an agarose gel IIl ladder one läñé ând 100 ng of a 500 bp DNA fragment in another lane. The gel is 0.5% agarose, and it is run for 45 minutes time at 200 V. When he checked the gel, he saw three bands in the Hind III lane and no other bands on the gel. What can be the reason behind this. What additional information we may need to be sure about the reason.