1. how to isolate 26s rRNA from water, surface of water and kelps surface 2. what is the PCR tool to use for 26s rRNA. 3. what is the background of the title: metabarcoding of yeast communities associated with kelp beds in marine ecosystem
Q: D A mutation in the Pitx1 gene prevents normal hindlimb formation in mouse embryos. Analyses of the…
A: Mutations are changes that occur in the DNA sequence of an organism's genome. They can be caused by…
Q: The muscle contractions required to maintain balance and posture while moving would be considered: O…
A: Muscular system is a body system which is involved in regular contraction and relaxation so as to…
Q: Saltatory conduction occurs on? Dendrites Cell bodies Unmyelinated axons…
A: Saltatory conduction is a type of nerve impulse conduction that occurs in myelinated axons, where…
Q: Suppose 0.240 gram of the green salt is weighed out for this experiment. What is the mass percentage…
A: The green salt which has Fe and is most commonly used in titration is Mohr's salt so we are…
Q: Each type of pre-mRNA processing has one or more important functions. Match each function with the…
A: The addition of a 5' cap to pre-mRNA has several important functions: Facilitating transport of…
Q: 1) What is the main reaction that causes monomers to build into larger molecules? (Spelling counts!)…
A: Introduction Macromolecules are large molecules that are composed of smaller building blocks called…
Q: How many sets of chromosomes does the pollen of an gymnosperm have?
A: Conifers and cycads and ginkgoes are examples of gymnosperms, which are seed bearing plants. They…
Q: Curare is a paralytic toxin once used by indigenous South American tribes to hunt game. The toxin…
A: Inhibiting acetylcholinesterase at the neuromuscular junction and Blocking reuptake of acetylcholine…
Q: Those phenotypes that are controlled by factors found in the cytoplasm of the female ovum are said…
A: Eukaryotic genome consist of nuclear genome and extra-nuclear or cytoplasmic genome ( mitochondria/…
Q: INTRODUCTION: Quadrat sampling is a classic tool for the study of ecology, especially biodiversity.…
A: Quadrat sampling: Quadrat sampling is a method of sampling biodiversity in which a plot of a fixed…
Q: Following a mutagenesis experiment to identify novel genes affecting the circadian clock in…
A: Based on the given information, we know that the c and d mutations are recessive, and that both the…
Q: You may want to have your macromolecules/biomolecules packet to help with this question. The image…
A: Enzymes are too specific, meaning that they can as they were catalyze particular responses, which…
Q: Which of the following is NOT true about infectious mononucleosis ("mono")? None of the other four…
A: Infectious mononucleosis is Caused by Epstein-Barr Virus, a type of herpesvirus: The Epstein-Barr…
Q: Why is penicillin toxic to bacteria but not to higher organism? Explain briefly
A: Penicillin is an antibiotic drug that was discovered in 1928 by Alexander Fleming, a Scottish…
Q: How does the kidney maintain the body's internal environment?
A: The kidney plays a crucial role in maintaining the body's internal environment, also known as…
Q: ab questions (due at the start of the You will examine four different phyla this week. Which of…
A: Acoelomates-An acoelomate is an animal that does not possess a body cavity or coelom.…
Q: different types of test that doctors preform to diagnois the disease. my question is, is there a…
A: Coronary artery disease is a condition in which the arteries supplying blood to the heart narrow or…
Q: 3. The cell growth in problem 1 is now transitioned to a 12.0 L continuously-stirred tank reactor (a…
A: Cells grow during a continuous bioreactor under continual feed supply and waste removal conditions.…
Q: How does lambda excise and replicate during the lytic cycle? Explain the factors that determine…
A: Lambda may be a mild bacteriophage that can coordinate its genome into the genome of the host…
Q: For the central nervous systems explain the functions and where relevant their relationships of the…
A: The Central Nervous System (CNS) is the most important unit in an organism as it is the ‘center’ or…
Q: Frank has shown symptoms of Korsakoff’s syndrome for the past ten years. Frank is LEAST likely to…
A: Korsakoff's syndrome is a type of amnesia that often affects long-term memory. People with this…
Q: Which process does NOT happen in the small intestine during lipid digestion? a. secretion of bile…
A: Answer 4: d. a, b, and c are the correct Answer 5: a. It hydrolyzes the bond between the fatty…
Q: In detail, explain the difference between Hodgkin's Lymphoma and non-Hodgkin's Lymphoma.
A: Introduction :- Hodgkin's lymphoma (HL) and non-Hodgkin's lymphoma (NHL) are both types of cancer…
Q: Different mechanisms create different types of chromosomal aberrations; for example, nondisjunction…
A: Introduction: Meiosis is a type of cell division that occurs in sexually reproducing organisms to…
Q: Give typing answer with explanation and conclusion 1) What is the purpose of the CD4 and CD8…
A: CD4 and CD8 are cell surface proteins found on T cells in the immune system. CD4 is primarily found…
Q: Which of the following is termed as conserved gene order? a) Microarray b) Ortholog c) Synteny d)…
A: A gene is a segment of DNA (deoxyribonucleic acid) that carries the hereditary information of an…
Q: The equilibrium constant for the chemical equation N2(g)+3H2(g) - - -2NH3(g) is Kp=0.0357 at 203 °C.…
A: In the given equation, there are 4 molecules of reactant (1 N2 + 3 H2) and 2 molecules of product (2…
Q: What mechanisms does the phagolysosome use to kill the thing that was brought into the cell?
A: Introduction The immune response is a complex biological process by which the body's immune system…
Q: Sheep and cow manure are used as inorganic fertilizers by farmers and gardeners.
A: Manure is the biodegradable fertilizer produced by the decomposition of plant and animal waste or…
Q: 4. Analyzing: A. Analyze the pedigree below and determine if the trait is inherited as autosomal…
A: The type of inheritance pattern shown in the above pedigree is X-linked recessive. It is x-linked…
Q: Mycorrhiza – What is mycorrhiza? Describe the differences between the two main categories…
A: Introduction Fungi are a diverse group of organisms that are found in almost every ecosystem on…
Q: Expiratory Reserve Volume + Residual Volume = Multiple Choice Capacity.
A: Vital capacity (VC) is the maximum amount of air that a person can forcefully exhale after taking a…
Q: b. A hamster has a heart rate of about 634 beats per minute. About how long will a hamster live?
A: The heart rate of hamster is 634 beats per minute. The life span and the heart rate of mammals are…
Q: Plants are living organisms that belong to the kingdom Plantae. They are multicellular eukaryotes,…
A: Introduction Plants are living organisms that belong to the kingdom Plantae. They are multicellular…
Q: Lane 1: A normal individual Lane 2: An individual homozygous for a deletion that removes the -50 to…
A: Northern blot, is a technique used to determine the genetic expression in the cells using RNA. It is…
Q: Are there any molecular factors affecting the drug darolutamide efficacy (i.e. mutations)?
A: Introduction Molecular factors refers to any molecular characteristics that influence the ability of…
Q: Explain the term "gender reassignment." Provide a description of the pros and cons of allowing this…
A: Gender reassignment is a surgical processor in which changes in the gender from birth gender to…
Q: A poultry grower has 2 breeds of chicken, averaging 9 and 5 lbs. In weight. The F1 of the cross…
A: When two different breeds of chicken are crossed, the F1 generation will typically have an…
Q: The allele "a" occurs with a frequency of 0.17 in a population of clams at Hardy- Weinberg…
A: Hardy Weinberg Equilibrium states the genetic equilibrium of the population. It is achieved when…
Q: RNA differs from DNA in that: All are correct ORNA contains ribose. RNA contains uracil ORNA is…
A: RNA stands for Ribonucleic acid. It is a type of nucleic acid that is found in all living cells. RNA…
Q: Is there any other existing gas that work in infection prevention (formaldehyde, ethylene oxide), if…
A: Infection is the invasion and multiplication of harmful microorganisms, such as bacteria, viruses,…
Q: Give typing answer with explanation and conclusion lets say, you treat a bacteria with an unknown…
A: When microbes are uncovered to antibiotics, "they learn how to resist them, which is known as…
Q: True or False: Omega 3 and omega 6 fatty acids can only be made by plants, though they can be…
A: Omega-3 and omega-6 fatty acids are essential polyunsaturated fatty acids that must be obtained…
Q: Gluconeogenesis is not a mere reversal of glycolysis, explain?
A: Gluconeogenesis and glycolysis both are metabolic pathways related to the metabolism of glucose and…
Q: In terms of cellular structure, what is the difference between plant and animal cell?
A: As we know all living entities have a basic structural and functional unit which is cell. There are…
Q: teven mixed 30 μL of cells with 150 μL of cell culture media, then transferred 10 μL to the…
A: A hemocytometer, also known as a counting chamber, is a laboratory device used to count cells or…
Q: Which of these organisms does NOT live in the human intestine? Select one: a.Acetobacter xylinum…
A: Introduction: A pathogen is a microorganism that can cause disease in a host organism, such as a…
Q: Give typed full explanation A drug has been developed that blocks complex 1 of the mitochondria…
A: The electron transport chain is a series of membrane-associated protein complexes located in the…
Q: A bacteriophage lytic development cycle is determined by the expression of its genes. How are these…
A: Bacteriophages are also known as phages, these are viruses that infect bacteria for the completion…
Q: What typical structure[s] is/are found in integral membrane proteins – how do they span the…
A: Introducion Cell membrane or plasma membrane separates the cell from outside environment. The plasma…
1. how to isolate 26s rRNA from water, surface of water and kelps surface
2. what is the PCR tool to use for 26s rRNA.
3. what is the background of the title: metabarcoding of yeast communities associated with kelp beds in marine ecosystem
Step by step
Solved in 2 steps
- 1. What is the difference between an iterated blast (psi-blast) search and a simple blastsearch?2. Arslan sequenced a gene in lab how he will know about the gene either it is noveldiscovery or gene is already present in the database?3. Ruwaifa want to compares a nucleotide query sequence what option he will opt inBLAST and why?4. Uzair has two protein sequences, he want to check their similarities what he will do? What results are expected1. Why do you think yeast is the one used for RNA extraction?2. Cite qualitative tests to characterized isolated RNA.OF intorcat A Intorest gone in a gene "gun," a bacterial material into the genetic material inserts itself into the chromosomes of the host plant. Engineers must also insert a "promoter" gene from a virus as part of the package to make the inserted gene express itself. . This process alone, involving a gene gun or a similar technique, and a promoter, is profoundly different from conventional breeding, even if the primary goal is only to insert genetic material from the same species (Hansen, 2000). host plant cells. Activity 4: Desirable Traits Directions: Study the plants and animals below that have desirable or enhanced traits. Explain how each of the characteristics was introduced or developed (i.e., classical breeding or recombinant DNA technology). MODIFYING TECHNIQUE (Classical breeding/ Recombinant DNA technology) REASON ENHANCED TRAIT 1. Kobe / Wagyu Beef (Beef with good fat distribution)
- 6. Explain why a positive test for COVID19 would appear sooner than a negative result when using real- time PCR to test if someone is infected. 7. Explain why the same primers (GMM) could detect several types of genetic modifications to common crop plants, rather than one specific gene or genetic modification. 8. Explain the general procedure for using the NanoDrop machine in analyzing DNA samples. Be sure to explain the purposes of the blanks (pure water), and of the importance of the 260/280 ratio. Identify an ideal 260/280 ratio of purified DNA.18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to amplify the following gene by PCR. GTAGAATATG ATAAGCGAAA CTGCAAATCG CGTTTGGGGC GATACAAGTA GTGTACGCGG ACCGCGCCGA GCGGGCTATG GTTTCTCCAC TATCAGTTCT TCTCCTGTCC CAGCGAAGTC GAGGTCCAGC CCTACGGTAC ATAACTAACA CGGTTTGAAG AAGATACGAT CTTACGAAGT AAAGAAAATT TGTAGTCAGC CCGGTTCGCT TGTGTCCAGC TAATCGATTG ATTGGCCCCA GCAGGCGAGA TGAACATAGT CATGCGCTGT CTAATAGCCC ATTTGACGTG TAGGTGGCGC TTTTATTTCT GAGGTGGAAA T a) If the primers were both 20 nucleotides long, what are the sequences for both PCR primers that will amplify only the highlighted region? Be sure to label the 5' and 3' ends. (4 points) b) What is the length (in bp) of the entire region amplified by their primers (i.e. the amplicon length)? (Note: the spacing in the above sequence is intentionally uniform) (2 points) c) If you start with 300 copies template DNA how many copies would you expect to produce if you ran the PCR for 22 cycles? Show your work.…Why is gene editing becoming a trend in modern genetic engineering? Provide a concrete example on your explanation. 2. Out of 4 presented methodologies in gene modification/editing, which do you think is the most promising in providing efficient result? Why do you say so? 3. What makes the species of Agrobacterium ideal for genetic engineering? Describe its characteristics and its role in producing transgenic plants. 4. In which of the following aspects do you think it is worthwhile to develop genetic engineering? Why or why not? a.) Agriculture and Food Industry b.) Medicine c.)Research d.) Entertainment 5. What are the possible bioethical issues that gene editing tools may encounter? 6. Do you think genetic engineers play God when they modify the genes of various organisms to enhance their existing traits? Why or why not?
- Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence. In a second color, act as the polymerase and fill in the rest of the new strand of DNA Primer/New Strand Template DNA: 3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’ Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…Metagenomics has revolutionized our understanding of the microbial world by allowing the study of organisms that had been impossible to culture. Understanding the Lokiarchaeota required metagenomics analysis, which has also led to the identification of the eukaryotic signature genes in other environments. The terms below relate to genes and genetic analysis. Drag each term to the correct description. Drag and drop the terms on the left to match the description on the right. ▸ View Available Hint(s) Submit Homologous Monophyletic Metagenomics Orthologs Paralogs and that has a different function (this occurs through gene duplication) : the study of genetic material from an environmental sample Reset : a group of organisms in a phylogeny that have a common ancestor : a gene that is related in different species by being inherited from a common ancestor Help and that has the same function : a gene that is related in different species by being inherited from a common ancestor : a gene that…23. Important elements of a directed evolution experiment (“evolution in a test tube”) for an ATP-binding aptamer include: MARK ALL THAT APPLY. Group of answer choices Mutagenic PCR DpnI restriction enzyme Randomized DNA pool ATP affinity column
- 2. You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below: 3'CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGG АТСАААААА5 Additional tools are provided below. Angela Parry-Hanson Kunadu & Dr. Joycelyn Quansah Page 1 of 11. Explain why the 16S rRNA gene sequencing is suitable for bacterial identification in general and why it is mostly limited to genus level.1. Below are the agarose gel electrophoresis and spectrophotometric measurement results (RNA concentration value and A260/A280 to A260/A230 ratios) of total RNA samples isolated from 4 different eukaryotic cells. 1. Explain the agarose gel image and spectrophotometer results of the 1st, 2nd, 3rd and 4th group RNA samples. 2. Are the 1st, 2nd, 3rd and 4th group RNA samples obtained pure? If it is not pure, write what kind of contamination, if any, is present in the RNA samples. 3. If there is contamination in the RNA samples belonging to the 1st, 2nd, 3rd and 4th groups, explain how they are eliminated. 4. Explain the reason for the contamination in the contaminated samples, which may have resulted from the error or deficiency in which step of the RNA isolation