Why is it so difficult to monitor the air real time for all of the pathogens we have studied? (Explain in a few sentences) For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac).
Q: How does cotton plug prevent contamination of the medium? [Answer in not more than 2 sentences
A: Cotton plugs are used in various experiments as lids to cover the mouth of the flask. It is usually…
Q: Why do critical instruments need to be sterile, whereas semicritical instruments need only be free…
A: Laboratory instrument is defined as a general term used for all kinds and types of instruments,…
Q: samples and trying to determine characteristics they contain. You determine sample M requires an…
A: On the basis of Habitat in which the microorganism live, these can be classified into many types.…
Q: Suppose you do this test on a hypothetical Staphylococcal species with the antibiotics penicillin…
A: Antibiotic It is an antibacterial chemical that is effective against bacteria. It aids in the…
Q: To decrease the unwanted biological damage for the patients during an x-ray test, we can: *
A: In laser production, increasing the density of the lasing medium will increase the number of photons…
Q: This is a figure from a recent paper comparing different bacterial pathogen strains. What is being…
A: Pathogens are microbes that cause disease in host.
Q: our own words. e
A: The total microbial count is one of the essential measures used in the management of hygiene. It…
Q: Escherichia coli For each of the following, describe what information the field knows now and what…
A: 1 Scientific study of microscopic organisms including micro organic pathogenic organism which is…
Q: Noah wanted to transfer Staphylococcus aureus from a broth to an agar plate. He picked up the broth…
A: The aseptic techniques are applied in the laboratory setup to reduce the risk of contamination. It…
Q: If you spread one agar plate with a lawn of staphylococcus epidermis and the other with a virulent…
A: The Kirby-Bauer test: It is known as the disk diffusion antibiotic sensitivity test. It is a test in…
Q: on the types of studies. Which sampling design you may recommend for the following experiments :…
A: Sampling methods play a very important role in investigation of various infection and disease either…
Q: ased on the results of the lab, fill in the following sentences. lace the terms in the appropriate…
A: Given: A table is given to complete the blanks.
Q: With antibiotic Without antibiotic 100 80 60- 40 20 Figure 3 % Survival maphylococcus aureus Vibrio…
A: Bacteria that acquire resistance genes, either through random mutation or genomic interchange with…
Q: Which of the following is FALSE about interpreting the results of normal microbial flora experiment?…
A: Normal microbial flora: Normal flora includes microorganisms (bacteria, fungi, viruses, and…
Q: Erythromycin, an antibiotic discovered in 1952 from soil bacterium Saccharopolyspora erythraea, was…
A: Microbiology is the branch of biology that deals with study of organisms that are too small to be…
Q: What is the purpose of the quadrant streak plate method? - How could this method be used in a…
A: In quadrant streak plate method, first of all the plate on which bacteria has to be grown that is on…
Q: Give the uses/functions and images of each apparatuses. Basic Laboratory Equipment Uses/Functions…
A: Note: I can't provide you with pictures. But i will explain you functions of these apparatus.…
Q: Please answer it Asap and avoid plagiarism for an Upvote. Thankyou. Compare and contrast the pour…
A: In the streak plate technique, a sterile inoculation loop is used. To obtain pure cultures, this…
Q: What are the characteristics of good indicator organisms, and whyare they monitored rather than…
A: Indicator organisms are microorganisms whose presence in water indicates the probable presence of…
Q: A patient arrives at a health center and the attending nurse suspects an infection. Describe the…
A: Emergency departments have more risk of infection due to encounters of many human-to-human contacts.…
Q: In the hospital setting, how effective is handwashing compared to hand sanitizer at controlling the…
A: Hands are the important vector in the transmission of the COVID-19 virus because the virus can…
Q: Explain why isolating a pathogen through standard culture methods may become an outdated diagnosis…
A: The term isolation refers to the separation of a strain from a natural, mixed population of living…
Q: Please match the type of culture to the statement that most accurately describes it to test your…
A: In microbiology, culture media is the media which is used to multiply the required microbes under…
Q: What is the importance of using a test/control organism in describing the cultural characteristics…
A: The food materials on which the organism is developed is called culture medium and the development…
Q: Which of the following is the most appropriate pairing of microbe and biosafety level?…
A: BSL 1 - bio safety level 1 -this type of Laboratories contain microbes that may or may not cause the…
Q: According to these images and your own knowledge, can you make a biological drawing of bacteria in…
A: Yoghurt is a nutrient which is rich in lactobacillus (lactic acid bacteria) . Convert milk into…
Q: After running a novobiocin sensitivity test, the zone of inhibition diameter measured 14 mm for one…
A: The microbiology studies about both the diseases causing microbes and beneficiary microbes, about…
Q: uipment is used to accelerate the growth of microorganisms in the experiment? (b) What is the…
A: The technique which uses practices and procedures to prevent contamination from pathogens is refers…
Q: Which of these microbial structures is the most difficult to kill when attempting to sterilize…
A: Answer of the question given below...
Q: A medium was inoculated with 5 * 106 cells/ml of Escherichiacoli cells. Following a 1-h lag, the…
A: Growth curves are generally the description of the density of cell populations in liquid culture…
Q: Aside from the school laboratory facilities, How can we apply Aseptic Techniques in the following…
A: Within the twentieth century, the world suffered pandemics. The pandemics, as horrifying and lethal…
Q: Describe three problems associated with using the standard plate count method for determining the…
A: Typically, an accurate count of bacterial colonies is required for biological processes. Microbial…
Q: Which one of the following microorganisms would you use as a quality control check to ensure that…
A: Answer: STERILIZATION TECHNIQUES = These are the techniques which we uses in laboratories in order…
Q: BAX vs VIDAS: Two automated methods for detection of pathogenic microbes How are these methods…
A: The detection of the pathogens helps in determining the identification of pathogens, food and…
Q: Before using the API® Staph System, what tests should be performed on bacteria to confirm that they…
A: API Staph (analytical profile index) is a systematized procedure used for the identification of the…
Q: If the bacterium was lysogenized by a bacteriophage that has a virulence gene, determine the kind of…
A: The phenotypic approaches involve identifying bacteria by taking into account their behaviour and…
Q: Which
A: Definition for BSL (biosafety level):- A specific combination of work practices, safety equipment…
Q: Indicate the steps you would take to identify and treatinfections from smallpox virus or anthrax in…
A: Smallpox is an infectious disease and is caused by the Variola virus. The risk of this disease is…
Q: what is the purpose of using oil immersion with the 100x objective lens? a)To prevent refraction of…
A: Answer is option a.) To prevent refraction of light.
Q: What is the importance of employing aseptic techniques? Give an example of a situation in the…
A: There are few important points: We all know that microorganism and pathogen that is disease causing…
Q: discuss which two rooms in your home or workplace that you believe are the most contaminated.…
A: Microorganisms are microscopic in nature and can be categorized into bacteria, virus, fungi, algae,…
Q: Which of the following is the most effective way to reduce the number of nosocomial infections? View…
A: An infection is the invasion of body tissues by disease-causing agents, their multiplication. The…
Q: Which of the following words apply to the overlay that maintains proximity between virus and…
A:
Q: In the hospital setting, how effective is handwashing compared to hand sanitizer at controlling the…
A: Hands are the important vector in the transmission of the COVID-19 virus because the virus can…
Q: what do the colors in the kirby bauer plate represent black/dark area = tan/yellow are small…
A: KIRBY BAUER METHOD- Antibiotic sensitivity test is performed by using the agar diffusion method in…
Q: Select an appropriate technique to identify a microbial genus, species, and strain
A: Microbes are small living things that cannot be observed with the naked eye. These live in soil,…
Q: isolating a suspected agent in a sick individual that is absent in a healthy individual is…
A: Answer: Introduction: Robert Koch is a German Physician established four postulates for causative…
Q: You are reading culture plates today and identifying pathogens that grow from patient samples. Which…
A: The culture plates for growing microbes hold importance in understanding and examining the…
Q: As a medical microbiologist, if you are presented with a patient suspected to have a bacterial…
A: Laboratory diagnosis involves the various tests and examinations of the patient sample. The…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Question #1 Explain how the high mortality during the 1918 worldwide influenza pandemic is example of failed tolerance by hosts to infection by Influenza A H1N1 (i.e draw and explain two figures as part of your answer). Edit View Insert Format Tools TableQUESTION 5You are asked to recommend an antibiotic to treat potential pathogenicityt in an animal. Describe a method which will allow you to make this recommendation.question: Can you summarize and explain for me what you want to tell in the article below? Can you explain the figure? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Nanotechnology Tools to Detect SARS-CoV-2 Standard procedures for detecting the virus from nasopharyngeal and/or oropharyngeal swabs have been reviewed recently and are primarily based on reverse transcription polymerase chain reaction (RT-PCR). Here, we would like to mention some preliminary ideas on nanotechnology-based assays to monitor the presence of SARS-CoV-2. A simplified test and variants thereof to detect viral proteins (e.g., HIV or influenza virus) without the need for expensive equipment is based on the color change of Au NPs bound to antibodies. Similar to the enzyme-linked immunosorbent assay (ELISA) antibodies coupled…
- Copy and paste the link below and watch the video in Youtube and Answer the Questionshttps://www.youtube.com/watch?v=8RBs0Ghg_48 Gel electrophoresis Questions 1. What are the chemicals and materials used in gel electrophoresis? 2. Draw a schematic diagram of a gel electrophoresis set-up3. Describe the procedure in doing a gel electrophoresis experiment. Why is there a need for a leveling bubble/leveler? What is the use of the rubber dam? 4. What is the use of ethidium bromide and why must you wear gloves when you handle it? 5. What makes the DNA fragment move towards the positive plate? 6. What is the purpose of glycerol in the sample buffer? 7. What is the use of a DNA ladder? 8. What will happen when you increase the voltage of the set-up? 9. Can gel electrophoresis be used to separate amino acids? If so, how is it done?QUESTION 1 The table below shows the results from looking at the diagnostic accuracy of a new rapid antigen test for COVID-19 in 100000 patients, compared to the reference standard RT-PCR test. The rows of the table represent the test result and the columns the true disease status (as confirmed by RT-PCR). COVID-19 Positive COVID-19 Negative Antigen Test Positive Antigen Test Negative 424 795 8216 90565 Calculate the SENSITIVITY of this new rapid antigen test as percentage with 3 decimal places. (Assume that the RT-PCR reference has a 100% Sensitivity and 100% Specificity.)QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…
- QUESTION 11 Below is a diagram of an assay you learned a lot about in class. In the third image, what is the little purple ball near the top supposed to represent? 1 O Analyte O a patient sample O An enzyme O A substrate A virus O An antibody 2.Question #3 Describe the general concept of trade-offs between virulence and transmission, and give several (at least three) instances where this trade-off does not occur, and why. In other words, why do we continue to have virulent pathogens? Edit View Insert Format Tools TableQuestion 14 What is the vaccine delivery system used in the Moderna's COVID-19 vaccine? O Fentanyl patches O target-controlled infusion (TCI) devices O Lipid Nanoparticles O Transdermal drug delivery
- ann Question 2 2 pts You have isolated a gram-positive bacterium with low G + C content from unpasteurized milk. It infected a pregnant woman, and now you are worried that her child will be stillborn. What bacterium is it? O Mycobacterium O Clostridium O Anabaena Listeria monocytogenes Next No new data to save. Last checked at 1:04pm Submit Quiz End Insert Dele Home F12 F10 F11 F9 FB F6 F7 F4 F5 Ba & $4 7 8 9. 4 T H. J K G M V PriSc Alt 立Quèstion 9 Match each term with its definition. M. sphere-shaped bacteria F. va type of bacteria that is resistant to antibiotics Lvthe proper use of body movements to avoid injury while lifting or moving E. va machine that sterilizes objects using steam spiral-shaped bacteria A v parasites that live on fleas, lice, or ticks and can cause typhus and other diseases v small, one-celled organisms that cause illness when they are out of balance in our bodies D. v rod-shaped bacteria v simple practices that reduce strain and effort, such as using wrist support while typing v the form and structure of an organism; for instance, spiral-shaped or rod-shaped v organisms such as yeasts and molds that can cause infections v microorganisms found in water and soil that can cause malaria and dysentery disease-causing organisms that live in human cells and cannot be killed with antibiotics A. rickettsiae B. morphology C. protozoa D. bacilli E. autoclave F. bacteria G. MRSA H. ergonomics I. fungi J.…QUESTION 8 Under which condition(s) can a disease become an epidemic? Choose all that apply. Ro = 0.8 Ro = 1 Ro = 1.1 %3D Ro = 3