Q: Identify the sense organs and adaptive structures used by the following vertebrates by completing…
A: Vertebrates show exceptional adaptations in their sensory organs to see and interact with their…
Q: Ecology Lab Worksheet 8: Species Diversity Habitat 1 Garage Lake N (Total number of individuals in…
A: Habitat 1: Garage Lake NTotal number of individuals in all species (N) = 325Number of species (S) =…
Q: Why do we use secondary antibodies in Western Blotting? Intensify signal from 1° antibody O Bind…
A: Western blotting is an analytical technique used to separate and identify proteins. It is also known…
Q: Please fill in the blank in the picture, thank you
A: Skeletal muscles are characterized by their voluntary nature. These are striated muscles that are…
Q: Shown below are several next-generation sequencing reads from a sample you have. Which of the…
A: Genomic research has been revolutionised by next-generation sequencing (NGS), commonly referred to…
Q: Which tissue would likely contain the least amount of carbohydrate? A) A crab shell B) A…
A: Carbohydrates are organic compounds that comprise of carbon, hydrogen, and oxygen, and they serve as…
Q: Multiple choice DNA polymerases can only elongate from: -Free 3’ hydroxyl groups -The area ahead…
A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA molecule. This enzyme is essential…
Q: 1 point Later on, you made a completely new cross. But you cannot remember the genotype from one of…
A: The objective of this question is to determine the genotype of the unknown parent in a genetic…
Q: Capsule C. Spleen While pulp Red polp White pulp Red pulp Trabecula Capsule Central artery…
A: The spleen is an important organ on the left side of the abdomen that filters blood, removes damaged…
Q: what is the mode of action of abamectin in insects?
A: Abamectin is an insecticide and acaricide derived from the bacterium Streptomyces avermitilis. It…
Q: Several factors (e.g., time and voltage) affect migration of DNA fragments through the agarose gel.…
A: A DNA fragment is a segment of DNA that has been cleaved or cut from a longer DNA molecule. DNA…
Q: Compare and contrast the nervous organs used by the following invertebrates. Complete the table.…
A: Although the neural architecture of invertebrates varies greatly among species, it typically…
Q: Intro to Neuroscience Question: An individual who has voluntary facial paresis has aberrations in…?
A: Voluntary facial paresis is a condition characterized by weakness of the facial muscles during…
Q: Describe how phagocytes recognize foreign cells.
A: Phagocytes are specialized immune cells that engulf and destroy foreign cells and debris. They play…
Q: Multiple Choices: At the replication fork, new DNA is synthesized by a: -RAS-RAF pathway…
A: This is the area where the actual DNA replication takes place.
Q: A gene product of unknown function was subjected to both two hybrid analysis and BioID. In the two…
A: Two-hybrid analysis is a molecular biology technique used to discover protein-protein interactions…
Q: Match the term in column 2 (A-G) with its definition in column 1. DOD Cloning vector Genome editing…
A: In the molecular biology, various techniques empower scientists to unravel the mysteries encoded…
Q: What is the endocrine system? What is it for? What is the lymphatic system? What is the main purpose…
A: The human body is an individual's structural makeup. It is made up of numerous cell types that…
Q: Birth Control Mechanisms (pick 5 and describe how it prevents pregnancy and how it’s used
A: When a fertilized ovum is planted in the uterus and develops into a fetus and embryo, the pregnancy…
Q: 1. If your PCR is inserted properly, where in the pCR 4-TOPO vector will it be inserted? 2. To use…
A: In molecular biology experiments involving PCR (Polymerase Chain Reaction) and vector insertion,…
Q: If 9% of an African population is born with a severe form of sickle-cell anemia (ss), what…
A: Sickle cell anemia is a genetic disorder that affects the red blood cells. Red blood cells normally…
Q: Describe the symptoms, pathology, and treatment of Alzheimer’s Disease at the introduction level…
A: A cellular mechanism for learning and memory, long-term potentiation (LTP) is the steady…
Q: 12. Which of these neurons is found in reflex arcs? a. Interneurons b. Sensory neurons c. Motor…
A: A neurological circuit that governs a reflex is called a reflex arc. The majority of sensory neurons…
Q: What is the difference between the vaginal ring and the IUD? What category does the vaginal ring fit…
A: The term contraception describes techniques or tools used to avoid getting pregnant. Birth control…
Q: To what class does this animal belong?
A: Mammals are warm-blooded vertebrates that nourish their young with milk produced by mammary glands.…
Q: In a cell that produces only one type of protein, which of the following statements about the…
A: hnRNA : The heterogeneous nuclear RNA is the bulk of transcribed RNA that has not been…
Q: What are some of the technical challenges of cloning a mammoth? Check all that are true Ancient…
A: Cloning a mammoth involves using advanced genetic engineering techniques to recreate a living…
Q: I am needing help with problems 1 and 3, please. Thank you. 1) Yeast uses anaerobic…
A: In aerobic respiration, the presence of oxygen, glycolysis, the Krebs cycle, and the electron…
Q: Does weight gain, high blood pressure, protein in urine, and edema are the symptoms of pre-eclampsia…
A: Pre-eclampsia is a pregnancy condition that is defined by hypertension and organ damage, most…
Q: In osmosis, water moves from an area of low solute concentration (high water concentration) to an…
A: Osmosis is the process of movement of solvents through a semipermeable membrane from a lower solute…
Q: Which of the following most closely depicts the order of the RAS-RAF pathway in mutated cells?…
A: The RAS-RAF pathway is a signaling pathway involved in the regulation of cell growth and…
Q: In contrast to histone acetylation, which always correlates with gene activation, histone…
A: Histone acetylation and deacetylation are the mechanisms that ensure that lysine residues inside the…
Q: Vaccination : "is an ounce of prevention worth a pound of cure?" what points can validate this…
A: The adage “an ounce of prevention is worth a pound of cure” is particularly apt when discussing…
Q: Answer both in a freewrite: 5 sentences max each 1. Explain why herbivorous mammals have longer…
A: Herbivores are animals that feed on plants, and plant derived products such as fruits and…
Q: An introduction provides a reader with information about the importance and purpose of the Brassica…
A: Brassica rapa, commonly known as field mustard or turnip, is a member of Brassicaceae family and…
Q: Why is washing with Hank’s balanced salt solution with 0.5% antibiotic-antimycotic done for…
A: A physiological saline solution known as Hank's balanced salt solution (HBSS) is used to keep cells'…
Q: A certain section of the coding (sense) strand of some DNA looks like this: 5- ATGGGCCACTCATCTTAG-3'…
A: Mutations are changes in the nucleotide sequence of DNA. The mutations can therefore affect the…
Q: Describe the molecular interactions that a cell uses to migrate through extracellular matrix. (use…
A: Cell movement through the extracellular matrix (ECM) may be a complex process that includes a series…
Q: Q1: Explain the structure and organization of muscle fascicles and their role in generating force?…
A: Muscles, the dynamic engines of movement in our bodies, exhibit intricate structures contributing to…
Q: most expensive dog breeds in the world
A: Thе most еxpеnsivе dog brееds in thе world oftеn rеflеct a combination of rarity, pеdigrее, and…
Q: What are hydrolase and lyase? 2. What is ligase and transferase? 3. What is isomerase and…
A: Enzyme is a protein that helps in catalyzing the various chemical reactions. The six major…
Q: Which part of the neuron provides insulation for the neurons, to prevent the loss of charged ions…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: The Calvin cycle (light-independent reaction) occurs in the Matrix Xylem Cristae membrane Stroma…
A: The Calvin Cycle, also known as the Calvin-Benson cycle or the dark reactions, is a series of…
Q: Q5.3. A group of biologists is studying the competitive relationships among strains of bacteria that…
A: Q.Explanation:- Any type of attraction between organisms is termed a biological relationship which…
Q: What is prevention in healthcare?
A: Prevention in healthcare refers to measures taken to prevent diseases rather than curing them or…
Q: A- Describe the anatomy and physiology of a dog's dewclaw.
A: A dewclaw is a vestigial finger found on the feet of many species. It frequently develops higher on…
Q: FRA
A: Skeletal muscles are the muscles that help us move our bodies. They're connected to our bones and…
Q: The fibronectin protein has a tripeptide segment with the sequence RGD, which is important in…
A: A peptide motif is a specific sequence of amino acids within a protein or peptide that serves as a…
Q: The statement "DNA → RNA → Proteins" -> is known as the central dogma depicts the regulation of gene…
A: The objective of the question is to understand the concept of the central dogma in biology, which is…
Q: Which of the following regarding GPCR's is FALSE?
A: GPCR is also known as G protein coupled receptor. It is an integral membrane protein that contains…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
What is the DNA template of the following DNA coding:
ATGGCTAACCTTGTA
Step by step
Solved in 3 steps
- Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Length
- Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGWhat restriction enzyme (or enzymes) would you use to cut the following... (Gene of Interest is Bolded) 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…
- The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?given the following DNA template, write out the cDNA, mRNA, tRNA anticodons, and give the amino acid sequence. what are the three possible outcomes if there ws a base substitution mutation were to occur to the template? template TAC CGC TCC GCC GTC GAC AAT ACC ACT#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: