What is the DNA sequence for the molecule shown here? НаС, OH 0- NH, EN -0-P-o NH2 -0-P- NH2 -0-P- OH
Q: What is an example of an unusual base pair interaction that is found in RNA but not DNA? 1. G-U…
A: RNA is composed of nucleotides attached together via phosphodiester bonds. DNA is also composed of…
Q: 11
A: Both and DNA are composed of nucleotides that contain pentose sugar, phosphate and nitrogenous…
Q: What sequence of bases on one strand of DNA is complementary to the following sequence on another…
A: Complementary bade pairs It is the phenomenon where in DNA Guanine always hydrogen bonds to…
Q: If thymine makes up 15% of the nitrogenous bases in a specific DNA molecule, what percent of the…
A:
Q: Which of the following disaccharide repeats is the most stable towards hydrolysis?…
A: Hydrolytic stability is the resistance of a cured polymer material to reverting to a semisolid or…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? I and…
A: In the 1950s, Erwin Chargaff, a biochemist, discovered that the nitrogenous bases (A, T, C, and G)…
Q: The compound shown here is used to treat trypanosome infection. What amino acid does the compound…
A: Trypanosomiasis or sleeping sickness is caused by a vector-borne parasite called tsetse flies which…
Q: What type of bond holds the nitrogen bases together in DNA? O covalent O hydrogen O peptide O ionic
A: Deoxyribonucleic acid (DNA) is the nucleic acid that is present as a genetic material in many living…
Q: 3. Figure 2 shows a type of biological molecule. Figure 2 H. H. H. HTHT H. H. H. .C .C H-C-0-C C-H…
A: Carbohydrates, proteins, and lipids are the three macromolecules. Lipids are different from all…
Q: Which of the following properties applies to DNA structure? Contains A, C, G, and U base pairs…
A: Nucleic acids are also called as polynucleotides, are made up of three components: nitrogenous base,…
Q: If one strand of DNA has the sequence A-A-C-T-G-T-G, what will be the nucleotide sequence of the…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which of the following is a difference between DNA and RNA? * O DNA is a single strand, but RNA is a…
A: Gene is known as the unit of heredity, which is transferred from one generation to the next. In most…
Q: G H2N (F) OH ్రింద A NH H2N (E) N ND O NH но NH (H) 18. Name of base A: 19. Name of base D: 20. Base…
A: Nucleic acid is one of the major cellular biomolecules. Nucleic acids are of two types. DNA and RNA…
Q: A sample of double-stranded DNA contains 20% adenine. Approximately what percent of the nucleotides…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: Label the parts of a nucleotide: 3. HG CH 1. 1. 0 2. HO P-0-CH 3. 2. HO Complementary base pair…
A: A nucleotide is a type of chemical molecule that makes up DNA and RNA. They play a role in cell…
Q: A polypeptide with a pH of 2.0 has a total net charge of 0. Gly-Pro-Glu-Asp-Leu-His-Ile-Gln-Asn-Phe…
A: This peptide is composed of glycine, proline, glutamic acid, aspartic acid, leucine, histidine,…
Q: Using the complementary base pairing rules in DNA, complete the following base pairs: 3D Adenine -i…
A: According to the complementary base pairing rule in DNA- Adenine and Thymine are complementary to…
Q: Choose the incorrect statement: Group of answer choices The two chains of RNA are held together by…
A: Introduction The nucleic acids(DNA or RNA) serve as the genetic material of the organism. This…
Q: NH NH2 HO-P-O-P-O-P-O HO. N. OH HO. OH
A: DNA is composed of deoxyribonucleotides. Deoxyribonucleotides are made up of a nitrogenous base,…
Q: This molecule is closely related to which the monomer of -0-P-o-P ---CH2 Adenine Tiphosphate group…
A: Cells have macromolecules which are basically polymers of smaller compounds. The monomers may be…
Q: The nucleotides are very specific as to which bond together. The four nucleotides are:Adenine (A)…
A: DNA nucleotides are adenine (A), thymine (T), guanine (G) and cytosine (C). These nucleotides come…
Q: What are the base pairing rules for DNA? Adenine (A) joins to i_and Cytosine (C) joins to ii (Choose…
A: DNA is a polymer which is made up of various nucleotides. Each nucleotides is made up of a…
Q: Guanine makes up 14% of the nucleotides in a sample of DNA from an organism. Approximately what…
A: The DNA has equal number of Guanine and Cytosine, and equal number of Adenine and Thymine pairs.
Q: guanine 1. only DNA uracil 2. only RNA ribose 3. both DNA and RNA forms a double helix phosphate…
A: DNA - Deoxyribonucleic acid RNA - Ribonucleic acid DNA - Only acts as genetic material RNA -…
Q: A nucleoside consists of (A) Nitrogenous base (B) Purine or pyrimidine base + sugar (C) Purine or…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What provides the negative charge associated with DNA? The phosphate groups The nitrogenous bases…
A: DNA (Deoxyribonucleic acid) is a molecule that is made up of two polynucleotide chains that coil…
Q: What binds the phosphate group and sugar of adjacent nucleotides in the DNA molecule? O non-covalent…
A: The self replicating by molecules that are present in the chromosomes and carry genetic information…
Q: The base content of a particular DNA molecule is 36% thymine. What is the percentage of each of the…
A: DNA consists of the bases adenine, guanine, thymine, and cytosine. These 4 bases together account to…
Q: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: O a. 10% O…
A: If a sequence of DNA has 20% Guanine bases, then it would have 30% Adenine. Hence, option (c) is…
Q: Adenine, cytosine, guanine, and thymineare the four nitrogenous bases found inDNA. For each…
A: DNA is made up of four nitrogenous bases-Adenine, Guanine, Thymine, and Cytosine. DNA is a double…
Q: This macromolecule is readily available and used extensively.The molecule below is a H-C-O HHHH H H…
A: Answer : Option (4) is correct. - triglyceride.
Q: What monomer combines to make DNA
A: Ans - Nucleotides are the monomers that makeup DNA. A base, a sugar (deoxyribose), and a phosphate…
Q: . chemical can used to cross link bio molecules -formamide -N-avetyl cysteine -hydrogen…
A: The chemical process of linking two molecules is known as crosslinking.
Q: Hc-OH HO -H H HC-OH он он Hc-OH H -OH This image shows two configurations of the same molecule,a(n)…
A: Monosaccharides are the simplest type of carbohydrate. Monosaccharides may be joined together by…
Q: Select all of the true statements regarding the molecule below: NH, 12 N: -NH G -NH2 ОН H,N ОН 'NH…
A: RNA is a genetic material of most of the viruses .It is either present in single stranded or in…
Q: Titration of alanine by a strong base, for example NaOH, reveals two pk's. Which is the titration…
A: A titration curve of an amino acid is the plot of the pH of the amino acid solution versus the…
Q: D. но- OH `NH Он но- OH ÓH NH2 NH OH EN HO-P-0 `NH2 НО -Р-ОН !! он он NH2 NH E.
A: Nucleoside is the structural subunit of nucleic acids that consists of a purine or pyrimidine base…
Q: Which type of nucleic acid contains ribose sugars? RNA neither DNA nor RNA both…
A:
Q: Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary…
A: Let us first understand the one letter codes for the given nucleotides: A is Adenine T is Thymine…
Q: Which methyl groups are from SAM? CH3 CH30 CH3 H3C H3C H3C' COCH3
A: Methylation is the process by which methyl groups (-CH3) are added to biomolecules by replacing a…
Q: A double-stranded molecule of DNA contains 120 cytosine (C) bases and 80 adenine (A) bases. How many…
A: DNA( Deoxyribonucleic acid ) is two stranded structure , which act as genetic material in most of…
Q: Cytosine 1. Cytosine found in DNA pairs with: Uracil 2. Guanine found in RNA pairs with: Guanine 3.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: One strand of a DNA molecule has the base sequence CCATTG. What is the base sequence for the…
A: Chargaff’s rule of DNA base pairing: Chargaff’s rule states that number of purines and pyrimidines…
Q: Which of the following has the sugar found in RNA? A. D. Но- OH HN. ÓH но ОН ОН В. E. NH2 H. OH…
A: RNA have the following nitrogen bases:- nitrogen bases in the RNA are - 1) Uracil , 2) Adenine , 3)…
Q: What type of nucleic acid does this complex occur? 2. Name the second nucleotide from the 3' to 5'…
A: There are two type of nucleic acids, DNA and RNA. DNA contains Adenine, Guanine, Cytosine and…
Q: Nucleosides differ from nucleotides by: The loss of the 2'-OH group ○ The addition of a 3'-OH group…
A: Nucleotides are the building blocks of nucleic acids. Nucleotides consist of sugar, base and…
Q: The word “atom” comes from the Greek word _____________ which means indivisible.
A: Elements are the atoms which are present in the atmosphere, there are different elements present.…
Q: H2N OH N' B) NH N. H2N NH" Но NH2 (H) 18. Name of base A: 19. Name of base D: 20. Base pair name of…
A: Since you have asked the question with multiple subparts we will answer the first three subparts for…
Q: To make Cytidine 5'-triphosphate we must ALWAYS first make which nucleotide? O Adenylate O…
A: Nucleic acids are composed of nucleotides. Nucleotides are made up of pentose sugar, nitrogenous…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Amino Acid: Asn-Met-Ser-Ile-Phe-Arg-Cys-Tyr-Lys What is the one letter code of this amino acid and what is its classification? What is the side chain description (e.g. amide, aromatic etc.)The melanocyte-stimulating hormone a-melanotropin has the following sequence: Ser-Tyr-Ser-Met-Glu-His-Phe-Arg-Trp-Gly-Lys-Pro-Val In the one-letter code of amino acids, this sequence would be: SYSMEHFRWGKPV STSMGHFAWGKPV O SYSMDHFAWGKPV O SYSMEHFAWGLPVWhich of the following is an anomer of B-D-gulopyranose? O O го ОН H ОН H ОН H H ОН CH₂OH -II- H H ОН ОН CH2OH H ОН ОН CH2OH О 0. H CH2OH то Н H H ОН H H - о H ОН ОН H ОН H ОН ОН H О ОН ОН H N
- Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopFirst letter U C A UUU UU JUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG ] Phenylalanine UCU (Phe) UCC UCA UCG Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Methionine (Met) Valine (Val) CCU CCC CCA CCG b) lysine c) methionine d) tryptophan ACU ACC ACA ACG GCU GCC GCA GCG C Second letter Serine (Ser) Proline (Pro) Threonine (Thr) Alanine (Ala) UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG ] Tyrosine (Tyr) Stop Stop Histidine (His) Glutamine (Gln) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) UGU UGC UGA Stop UGG Tryptophan (Trp) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG ] 1. List the mRNA base codons for the amino acids listed below. 2. a) aspartate: Cysteine (Cys) Serine (Ser) U C Arginine (Arg) A G Arginine (Arg) U C Glycine (Gly) A G U C A G U MCAG АCut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are present after the protein is treated with Trypsin? Val-lle-Arg-Lys-Leu-Arg-Gly-Ala-Lys-lle 6. 10
- Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.Umoles SH 2. ASE-3: A polypeptide that has the smell of a rotten egg was extracted from plant. You being a good MD with excellent knowledge of biochemistry performed the following: Titrated the polypeptide with DTNB. The absorbance of the obtained yellow color was 0.16. I. 1. Compared to a standard curve of-SH (Curve A below ), the estimated free -SH is A. Not possible to determine unless the polypeptide amino acid composition is known B. 1 umole of Cys C. 1 umole of either methionine or cysteine 2. Treatment of the polypeptide with DTT followed by DTNB yielded an absorbance of 0.81, indicating that the polypeptide: A. Contains 5 disulfide bridges B. Contains 5 Cys C. Was inaccurately titrated in the above situation yielding lumole D. Contains 3 intra-molecular disulfide bridges. 5. 4. 1. 0.2 0.4 0.8 1. Abs orbance 3. The polypeptide is composed of deca and nona peptides with: N- terminals of ala and val respectively and C-terminals of asn and lys respectively. The Decapeptide is…CH₂, H H 0=400 | | | CH₂ H H 1 HIG H-C-O H₂C-N-C-C-O-P-O-C-H 1 H 2 P=O =o HIGI HIGI HIGIN H HH H- HI HIG H- H— HHHHHH H HHHHH HHHHHHH HH Which part(s) is/are slightly polar? [Select] H 3 The top chain in part 3 is [Select ] [Select] H H 4 H H HH HH TI II H H Which are highly polar? all of these, parts 1-3 Which part(s) is/are nonpolar? [Select] H H C H 41 H HHH C- What is this molecule? (Looks scary but look how it has those tails) [Select] HH H H ✓faces When placed in oil, out towards the oil. When placed in water, part 1 faces out towards the water.