The reaction shown below occurs in glycolysis. Which of the following is false about this reaction? [Note: only major metabolites are given] 2-0, PO 1 H-C-OH CH₂OPO 天 H-C-OH CH₂OPO,²- The substrate gets oxidized during this reaction. This particular reaction uses phosphorylase enzyme. The substrate gets phosphorylated during this reaction. This particular reaction uses kinase enzyme
Q: What is the major function of cholesterol esters? O Make cholesterol more hydrophobic so they can be…
A: Cholesterol esters are chemical compounds formed by the esterification of cholesterol molecules with…
Q: Please help me fill out this worksheet
A:
Q: STEM Workplace Practices Q4
A: The objective of this question is to understand the difference between a product contaminant and a…
Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…
A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: Genetics Question 24
A: The question is asking for the number of sister chromatids in a unicorn cell at metaphase of…
Q: A gene encoding a miRNA was mutated so that it forms a perfect complement to its target mRNA. This…
A: MicroRNAs (miRNAs) are a class of small, non-coding RNAs that play a pivotal role in the regulation…
Q: Free energy diagrams are super fun to draw! Draw a set of free energy diagrams that show the…
A: Free energy diagrams have free energy (G) in Y-axis and reaction coordinate in X-axis. These can…
Q: Extension Questions Which of the following sequences correctly represents the flow of electrons…
A: Extension questions •The correct sequence representing the flow of electrons during photosynthesis…
Q: Genetics Question 8
A: The objective of the question is to identify the correct event that occurs during the prophase of…
Q: How does the predicted molecular weight of AlaE (16949.07) compare with the molecular weight of the…
A: SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…
Q: 1. Base-pairing. In DNA, A bonds with T and G bonds with C through hydrogen bonds. Hydrogen bonds…
A: Hydrogen bonds are formed between a hydrogen bond donor and a hydrogen bond acceptor.Hydrogen bond…
Q: To oxidize the fatty acid molecule shown below, what enzyme(s) are needed in addition to the enzymes…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: 1. Rank the following amines from lowest to highest boiling point. Explain your reasoning. CH3…
A: Answer 1correct order is B< A< CExplanation:Step 1: Step 2: Step 3: Step 4:
Q: 2. Draw the ringed form of D-glucose with the following modifications: (a) Convert to sugar acid at…
A: Below answer given Explanation:Step 1:(A) Step 2:(B)(C)&(D) Step 3: Step 4:
Q: Genetics Question 12
A: The objective of the question is to identify the stage of cell division during which crossing over…
Q: From the chart below, comment on the effect of substrate concentration on the rate of reaction.
A: Here we are using 10 tubes. A specific substrate concentration is used in two tubes each. For…
Q: Need help with Chm question
A: The required answer is given belowExplanation:Step 1:Step 2: Step 3: Step 4:
Q: In three sentences describe how Sanger sequencing works
A: Copying DNA: To determine the sequence of DNA, scientists start by making many copies of the DNA…
Q: Find the structure of insulin online.Draw the tripeptide at the beginning of the Chain A and the…
A: Insulin is a peptide hormone composed of two polypeptide chains, usually referred to as Chain A and…
Q: Which of the following is true about a mixed type inhibition? a. None of these is true b. A…
A: The enzyme kinetics, inhibition in particular, is vital to understanding and purposefully managing…
Q: The 5’ cap is involved in all the following except: Question 19 options: Splicing exons…
A: The processing of mRNA formed from transcription is called post transcriptional modification. Thes…
Q: Do Km and Vmax get affected by available enzyme concentration? Explain.
A: Enzymes are proteins that catalyse biochemical reactions. Michaelis Menten postulated that free…
Q: Several general characteristics of metabolic reactions or reaction pathways are listed. Classify…
A: Metabolism is the sum total of all chemical reactions taking place in an organism. It can be…
Q: Which of the following is(are) formed upon addition of 1 mol of Br2 to 1,3-cyclohexane? Br Br 1, 2…
A: for given chemical reaction,Option 4 is correct.(only 2 and 4)Explanation:Step 1The role of reagents…
Q: A potent inhibitor effectively inhibits an enzyme catalyzed reaction. What kind of a Ki value you…
A: An inhibitor is defined as a molecule that binds to an enzyme and decreases its activity whereas a…
Q: The kinetic data in the following table were obtained for the reaction of carbon dioxide and water…
A: The substrate affinity of CO2 for carbonic anhydrase or Km is found to be 10 mM.Explanation:Step 1:…
Q: Genetics Question 17
A: The question is asking whether the number of sister chromatids in a cell at metaphase of meiosis 1…
Q: What does it mean for fatty acids to be essential? What are the essential fatty acids?
A: Fatty acids are long-chain carboxylic acids. They are used by the body for various purposes like…
Q: The enzyme that catalyzes the formation of the peptide bond is located: in the large ribosomal…
A: During translation amino acids get linked to each other via peptide bonds. The enzyme responsible…
Q: phosphofructokinase reaction of Fructose-2,6-bisphosphate is a regulator of both glycolysis and…
A: Activates glycolysis and inhibits gluconeogenesis:Increased levels of…
Q: A useful method for studying membrane proteins in place in the membrane is a. nuclear magnetic…
A: Membrane proteins are common proteins that are the part of biological membranes.
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: The production of ATP in liver cells when the malate-aspartate shuttle isn't working properly. The…
Q: Draw the reaction between sphingosine and arachidonic acid and draw the full structures
A: Sphigosine is the platform molecule of sphingolipids. Arachindonic acid is a 20 carbon fatty acid…
Q: (a) In the space below draw a free energy landscape diagram for the conversion of substrate (S) into…
A: Transition state theory states that as a substrate is converted into a product, a high energy state…
Q: 3. What is something noteworthy about the following sugar modifications in terms of their…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Cooperativity yields a sigmoidal kinetic curve. Which of the following is TRUE?
A: Co-operativity can be described as a phenomenon where the enzyme shape changes with the substrate…
Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…
A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…
Q: 1. Suppose the following kinetic data was collected for an enzymatic reaction For each substrate…
A: Enzyme are proteins that catalyse the conversion of substrate into product. The mathematical…
Q: Explain the concept of protein folding and its importance in determining protein structure and…
A: The objective of this question is to understand the concept of protein folding and its significance…
Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…
A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…
Q: Answer the following questions concerning sulfathiazole below by filling ieach blank with the…
A: Step 1: In sulfathiazole, the nitrogen atom is indeed sp² hybridized. This means that one of the…
Q: ou are studying the tripep de Lys-Val-Thr. a) Could you use the absorbance at 280 nm to determine…
A: Protein concentration can be determined using spectrophotoscopy. Here, the absorbance of a protein…
Q: Question 12 In the tertiary structure of a protein, the R-group of valine can interact with the…
A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…
Q: Q5. A sh mutant called shXS is isolated that produces a truncated polypeptide of only 6 AAs in…
A: The objective of the first question is to identify a single basepair DNA change that would lead to a…
Q: Problem 3
A: The objective of the question is to determine the genetic distance between two genes, F and G, in…
Q: addition to L-lactate, which of the following molecules is (are) generated by fermentation of…
A: Fermentation is an anaerobic process that occurs in the absence of oxygen, leading to the conversion…
Q: 13. The structures of sphingosine and choline are given below. Draw the condensed structure and…
A: Sphingolipids has sphingosine as its platform molecule. Onto this sphingosine, a head group and a…
Q: The protein on the right called desmolaris, also called Draculin, found in bats. It is a non…
A: An injury to blood vessels leads to the leakage of blood and this is stopped via a process called…
Q: The Drug AZT is used to treat AIDS, This drug is a _____ Inhibitor/Activator of _____ a)…
A: HIV stands for human immunodeficiency virus. HIV destroys a type of white blood cells that help the…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The enzyme that catalyzes reaction below can be classified as: CoO COO NAD+ NADH + H* Но- | malate -C- H-Ć- dehydrogenase Охaloacetate Malate isomerase lyase hydrolase oxidoreductase ligase transferaseA(n) _________ reaction converts glycylalanine to glycine and alanine. This reaction requires __________. Blank 1 options- Oxidation-reduction Hydrolysis Isomerization Group transfer Internal rearrangement Blank 2 options- H2O and apeptidase or a protease H2O and a phosphatase ADP and a phosphatase NAD+ and a peptidase or a proteaseThe free energy change of each step of glycolysis is given in the table below. ∆G°’ is the free energy under standard conditions (25°C, 1M each reactant, pH 7), while ∆G is the free energy change at presumed physiological conditions. Why must no step have a positive ∆G under physiological conditions?
- The glyceraldehyde-3-phosphate dehydrogenase reaction of glycolysis, (glyceraldehyde-3- phosphate → 1,3 bisphosphoglycerate) (Choose all that apply) O conserves energy by transfer of a proton H* to NAD+ forming NADH O has a high energy thioester intermediate on the enzyme/substrate complex O mechanistically uses covalent catalysis O conserves energy in the formation of a oxygen phosphoric ester O conserves energy in the formation of a carboxylic-phosphoric mixed anhydride O mechanistically requires the coenzyme thiamine pyrophosphate (TPP) to act as an electron sinkMatch the following B vitamins with the roles of their coenzymes: riboflavin [ Choose ] niacin [ Choose ] pantothenic acid [ Choose ] vitamin B6 [ Choose ]Which one of the following regarding the chemistry of glycolysis & gluconeogenesis is FALSE? Reaction 6 of glycolysis catalyzed by glyceraldehyde-3-phosphate dehydrogenase involves oxidation & addition of a P; group. Reaction 3 of gluconeogenesis catalyzed by enolase involves hydration, the addition of water to a carbon-carbon double bond (C=C) to form an alcohol. Reaction 1 of gluconeogenesis catalyzed by pyruvate carboxylase involves decarboxylation. Reaction 9 of gluconeogenesis catalyzed by fructose-1,6-bisphosphatase involves dephosphorylation (phosphoester hydrolysis). Reaction 1 of glycolysis catalyzed by hexokinase involves phosphorylation (using ATP). O 0000
- Consider the following mechanism: What kind of reaction is occurring during this step of glycolysis? What metabolite is in Box 1? What metabolite is in Box 2? What metabolite is in Box 3? What enzyme catalyzes this reaction? Circle and label one place on the mechanism where covalent catalysis is occurring. Suggest an amino acid that could fill the role of residue “A” in the mechanism above and draw its structure at pH 7.4. Suggest an amino acid that could fill the role of residue “B” in the mechanism above and draw its structure at pH 7.4. Under standard conditions, this reaction is unfavorable (DG¢° = 23.8 kJ/mol). What conditions in the cell allow for the actual free energy change to be lower (DG » 0), making the reaction readily reversible? Explain your answer. *please help and explain as well as you can*Consider the following reaction occurring at 298 K: OH CH₂OH OH -0. OH OH +ATP k₁ k₂ 0- OCH, OH OH 0 OH OH Glucose Glucose 6-phosphate Hexokinase is an enzyme that catalyzes this reaction. When the hexokinase is present the rate of k₁ is 1.3 X10-3 M-15-1 Calculate the activation energy for the hexokinase catalyzed forward reaction.. +ADPIn the beta oxidation of linoleic acid, converting the 3, 5, 8 trienoyl CoA intermediate back to an expected intermediate for a beta oxidation substrate costs the equivalent of how many ATPs? (hint: look at the 'right side' of the figure for addressing problem 3 with linoleic acid)
- Draw OUT THE arrow pushing reaction mechanism for the following steps of glycolysis: SHOW/IDENTIFY the arrow pushing mechanism in at least 2 steps. CH,OPO CH,OH hexokinase 2+ H H H H H H ОН + ATP OH H ADP + H+ H ОН + НО HO OH H ОН H ОН Glucose-6-phosphate (G6P) GlucoseThere are eight chemical reactions that occur in the citric acid cycle process. The reactions of the citric acid cycle are shown in the figure below. acetyl-coenzyme A 0 CH₂-C-CoA HO-CH Reaction 7 O malate CH₂ CH || CH fumarate FADH₂ Reaction 6 FAD H+ + NADH NAD+ 1,0 H₂C CH₂ CH₂ Reaction 8 succinate ADP 0=C GTP CH₂ oxaloacetate Reaction 5 H-COA GDP ATP H₂O Reaction 1 C Reactions of the Citric Acid Cycle CH₂ CH₂ H-COA 0=C 1 CoA succinyl-CoA H+ HO-C Reaction CO₂ с CH₂ NADH CH₂ citrate Reaction 2 H-COA Reaction 3 CO₂ I CH₂ T CH₂ 0=C NAD+ HO–CH a-ketoglutarate CH, CH isocitrate NAD+ H+ + NADH In chapters 9 and 10, you were introduced to several classes of organic reactions. These classes include esterification, decarboxylation, hydration reactions, dehydration of alcohols, oxidation of alcohols, oxidation of aldehydes, reduction of aldehydes, and reduction of ketones. Find at least one of these reaction classes in the citric acid cycle. List the reaction number and the reaction. Write a…Which of the following statements regarding the catalytic mechanism of superoxide dismutase is true? The D residue does not participate in acid-base catalysis during the course of the catalyzed reaction All of the answers are true The coordinated Zn2+ participates in stabilizing Cu²+ in the reduction-oxidation reactions to consume O₂ The Cu²+ coenzyme is coordinated by H residues, positioning it precisely for consumption of 0₂ The overall reaction consumes two equivalents of O₂ and two proton equivalents in order to produces one equivalent H₂O2