The number of bacterial cells in a culture broth is to be determined by a culture technique. Serial dilutions were performed and a 0.1 mL aliquot from each dilution was spread onto Plate Count Agar (PCA). The number of bacterial colony forming units (CFU) after overnight incubation are shown as listed in the table below. What is the number of colony forming units per mL of the culture broth? Choose only the most appropriate plate for your calculation. Give your answer as the number only (do not add text for the units). You may use scientific notation with the format 1.12e+6 (that is, 1.12 x 106 cfu/mL). (Note: Canvas will then display your answer a whole number.) Plate Dilution Plate 1 10 dilution Plate 2 10 dilution Plate 3 10 dilution Plate 4 10 dilution Plate 5 10 dilution -8 dilution Plate 6 10 *Too many to count Number of colony forming units (CFU) TMTC* 382 83 10 2 0
Q: Peripheral Nervous System can be separated into Controls voluntary movements of skeletal muscle and…
A: One part of the nervous system is the peripheral nervous system (PNS). Outside of the brain and…
Q: Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I…
A: To identify the open reading frame (ORF) in a given DNA sequence, we need to locate the start codon…
Q: Five different types of taste receptors have been identified in humans. These are salty, sour,…
A: The perception of taste and smell are closely related, and together they contribute to our sense of…
Q: Trachea cannot be ventilated. im confused by what ventilated means here
A: The respiratory system includes the trachea, which aids in the exchange of gases between the lungs…
Q: Solid tumors of connective tissue such as muscle, bone, cartilage, and fibrous tissue (rare in…
A: Cancer is a broad term used to describe a group of diseases characterized by the abnormal and…
Q: Consider the following sample dataset of character traits for five taxa (A, B, C, D, and E) and an…
A: In order to identify which character traits are ancestral and which are derived, we need an outgroup…
Q: Use the following information to answer the next 2 questions. Advertisements for a new energy drink…
A: A drink or beverage which contains large amount of sugar , caffeine and other additives is known as…
Q: A colony of woolly-winged bats inhabited an isolated cave in Canada. Some of the bats had light-…
A: Genetic drift is a mechanism of evolution that results from random changes in the frequency of…
Q: Discuss two possible 'magic bullets' you have already learned about for targeting bacteria with…
A: Toxin: A toxin is a metabolic product of the organism that damages the host. Bacteria: They are…
Q: Bayesian updating can be a useful tool for thinking about the development of behavior. Imagine the…
A: The Bayesian view is a way of modeling how individuals update their beliefs based on new information…
Q: 14. Cevimeline (EVOXAC) a. dilates bronchioles b. is a potent vasoconstrictor c. increases heart…
A: "Since you have asked multiple questions we will solve the first question for you. If you want any…
Q: What evidence-based approach or process would you use to determine the effectiveness of change or…
A: To assess the impact of a change or intervention aimed at retaining hospital workers in expensive…
Q: The GREEN line on the graph represents which of the following in the course of an infection with HIV…
A: AIDS It refers to Acquired immunodeficiency syndrome which is a life- threatening disease, caused by…
Q: Based on the molecular data, which species is most closely related to humans? A) lemur catta (lemur)…
A: Sequence analysis refers to the computational analysis of DNA, RNA and peptide by comparing their…
Q: How many moles of ATP would be formed from 10.5 moles of NADH and 6.75 moles of FADH₂ during…
A: The electron transport chain within mitochondria transfers electrons across the inner mitochondrial…
Q: Two populations of beetles live in a desert environment, separated by a wide river. A sudden climate…
A: Speciation: When a group of organisms belonging initially to the same group, get separated into two…
Q: What makes automation of the polymerase chain reaction much easier? a. Capillary electrophoresis b.…
A: PCR means polymerase Chain Reaction. This is a procedure where a given target sequence can be…
Q: Give typing answer with explanation and conclusion What is an endangered plant species? Why should…
A: An endangered species is an animal or plant that is thought to be on the verge of extinction. Native…
Q: Two populations of the same species of frogs have been separated by a mountain range for thousands…
A: Reproductive isolation indicates the inability of interbreeding between closely related species…
Q: On the lush exomoon Pandora, scientists found a type of frog call the “balbasaur frog” whose males…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: A student compares the emissions from various energy sources. Which energy source would produce the…
A: Energy production and consumption are vital to modern society, but they also have a big impact on…
Q: (Practice Hint: Click or tap the boxes in the table to place check marks. Click or tap a check mark…
A: Respiration is a process of metabolism in which an organism's living cells use oxygen to obtain…
Q: Compare and contrast the use and application of serological techniques in disease detection.
A: Serological techniques involve the detection and analysis of antibodies, antigens & other…
Q: Question 1 1) Give the main aim of the article. (5) 2) Name five C3 and C4 grasses in an upland…
A: The photosynthetic pathway of grasses collected in several vegetation formations in Sao Paulo…
Q: About one child in 14,400 is homozygous for the recessive trait of albinism. Assuming that all…
A: The Hardy-Weinberg equilibrium is a principle in population genetics that describes the relationship…
Q: O RR round) O Rr (round) MM miley) Codominant Trait (mouth shape) Mm (straight) (oval) G Ⓒ Multiple…
A: Genes determine traits. A gene is made up of two allies which have contrasting pair of…
Q: 4. Albinism is lethal in plants, but many plants produce albino offspring. If albino plants always…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: expecting mother learns that her unborn child has a weight estimate that reads z=0.15 at this point…
A: Z score is standardisation score. It gives the number of standard deviations by which the value of a…
Q: True or false 1. Increased susceptibility to pyogenic (pus-forming) bacterial infections often…
A: HIV stands for Human Immunodeficiency Virus, which is a virus that attacks the immune system,…
Q: why dogs bark
A: Communication is the process of passing information from one animal to another causing a change or…
Q: does the process of photorespiration waste atp
A: Photorespiration is defined as a respiratory process in higher plants by which they will consume…
Q: a.Describe what makes thioglycollate medium suitable for culturing anaerobes. What would the growth…
A: A gel or liquid that contains nutrients and is used to cultivate bacteria or other microorganisms is…
Q: Indicate whether each of the following statements about natural selection is true (T) or false (F).…
A: Fitness is a measure of reproductive success (how many offspring an organism leaves in the next…
Q: Most medically useful antibiotics interfere with either peptidoglycan synthesis or ribosome…
A: Antibiotics are the antimicrobial drugs that prevent the growth of bacteria. These antibiotics have…
Q: In the reaction, 6CO2 + 6H₂O → C6H12O6 + 602, which side should the light energy be placed on? O The…
A: In the context of chemical reactions, energy considerations play a vital role in determining the…
Q: One of three mechanisms of ER membrane remodeling is motor-independent membrane sliding along…
A: Endoplasmic reticulum (ER) membrane remodelling is a crucial cellular process in which the size and…
Q: Imagine that you are observing a population of bacterial cells that are infected by a virus. You…
A: Given: The third question need to be answered. The bacterial cells are infected by the enveloped…
Q: Note that it is not appropriate to self-diagnose outside of a medical context and this is a…
A: A rash is a skin irritation or discoloration that may appear as red, raised bumps, blisters, or…
Q: Which oxide is amphoteric? None of these options would be considered amphoteric All of these options…
A: An amphoteric oxide is an oxide that can react with both acids and bases, behaving as either an acid…
Q: write an essay to Compare the processes of glycolysis and gluconeogenesis under the following…
A: Glycolysis and gluconeogenesis are two opposite metabolic pathways present in the metabolism of…
Q: RECOVERING KEY SPECIES FOR ECOSYSTEM RESTORATION ANSWER in ONE-TWO Sentence(s). 1. What is the…
A: In order to increase the ecological functionality and services provided by damaged or degraded…
Q: Below is an image of a basepair and associated ribose rings as viewed down the helical axis in B DNA…
A: DNA (deoxyribonucleic acid) is a double stranded helical molecule found in all living animals which…
Q: 4) Drug A is administered as a racemic mixture. The renal clearance of the (+) isomer is 90 mL/min,…
A: Renal clearance is a measure of the speed at which the kidneys are removing material from the blood…
Q: Genes that normally regulate cell growth & division are referred to as O a) proto-oncogenes Ob) ATM…
A: Cancer is a severe disease. In this, cell start divide abnormally due to some changes in the gene or…
Q: Question 28 Receptors for which of the following hormones activate AKT kinase as part of their…
A: AKT kinase, also known as protein kinase B (PKB), is a serine/threonine kinase that plays a central…
Q: General characteristics and classification of paramyxoviruses. Features of laboratory diagnosis of…
A: Paramyxoviruses are a family of RNA viruses that can cause a variety of respiratory and systemic…
Q: In the brain, Alzheimers disease is linked to accumulation of a) amyloid plaques outside cells and…
A: Alzheimer's disease is a progressive neurodegenerative disorder that affects the brain, causing…
Q: Purple loosestrife (Lythrum salicaria) and musk thistle (Carduus nutans) are ruderal plants that are…
A: This study analyzes the community interactions between the invasive plant species musk thistle…
Q: A C4 plant minimizes photorespiration by (note that we are talking about standard C4 plant, not CAM…
A: CAM stands for Crassulacean Acid Metabolism and it is a mechanism of photosynthesis involving double…
Step by step
Solved in 3 steps
- The number of bacterial cells in a culture broth is to be determined by a culture technique. Serial dilutions were performed and a 0.1 mL aliquot from each dilution was spread onto Plate Count Agar (PCA). The number of bacterial colony forming units (CFU) after overnight incubation are shown as listed in the table below. What is the number of colony forming units per mL of the culture broth? Choose only the most appropriate plate for your calculation. Give your answer as the number only (do not add text for the units). You may use scientific notation with the format 1.12e+6 (that is, 1.12 x 106 cfu/mL). (Note: Canvas will then display your answer a whole number.) Plate 1 10 Plate 2 10 Plate 3 10 dilution dilution dilution Plate 4 10 dilution Plate 5 107 dilution Plate 6 10 dilution -6 *Too many to count Number of colony forming units (CFU) TMTC* TMTC* 840 28 19 1The number of bacterial cells in a culture broth is to be determined by a culture technique. Serial dilutions were performed and a 1 mL aliquot from each dilution was mixed with warm molten agar and poured into a Petri dish. The numbers of bacterial colony forming units (CFU) after overnight incubation are shown in the table below. What is the number of colony forming units per mL of the culture broth? Choose only the most appropriate plate for your calculation. Give your answer as the number only (do not add text for the units). You may use scientific notation with the format 1.12e+6 (that is, 1.12 x 106 cfu/mL). (Note: Canvas will then display your answer a whole number.) Plate Dilution Plate 1 10 dilution Plate 2 10 dilution -5 Plate 3 10 dilution Plate 4 10 dilution Plate 5 107 dilution -8 Plate 6 100 dilution *Too many to count Number of colony forming units (CFU) TMTC* TMTC* TMTC* 867 154 18The number of bacterial cells in a culture broth is to be determined by a culture technique. Serial dilutions were performed and a 1 mL aliquot from each dilution was mixed with warm molten agar and poured into a Petri dish. The numbers of bacterial colony forming units (CFU) after overnight incubation are shown in the table below. What is the number of colony forming units per mL of the culture broth? Choose only the most appropriate plate for your calculation. Give your answer as the number only (do not add text for the units). You may use scientific notation with the format 1.12e+6 (that is, 1.12 x 106 cfu/mL). (Note: Canvas will then display your answer a whole number.) Plate Dilution -3 Plate 1 10 dilution Plate 2 10-4 dilution Plate 3 10-5 dilution Plate 4 10 dilution Plate 5 10 dilution -8 Plate 6 100 dilution *Too many to count Number of colony forming units (CFU) TMTC* 1,957 65 21 1 0 m
- You are given a bacterial culture which has a concentration of approximately 5.0 x 10^8 cells/mL. List a series of dilutions and platings that you could carry out in order to determine the exact concentration of the culture. Note that you must plate four plates from a minimum of two dilution tubes. The volumes plated should be in the range of 0.1 mL – 1.0 mL. Duplicate volumes may not be plated from any one dilution tube. Each plating should aim for a count between 30 and 300 CFUs. You can select any value from 30-300 for CFU and any volume from 0.1-1.0 to find out dilution schemeGiven the illustration and values below, determine the concentration of the original sample. Report results in CFU/mL or colony-forming unit/milliliter. Note that in order to observe the accuracy of results, culture plates with countable colonies between 25-250 CFU are considered in standard bacterial plate count.Given the scenario, compute for the total volume of the culture media solution (milliliter or liter) and dehydrated media (grams). Scenario: The students of a Microbiology class were tasked to transfer or subculture a pure culture of Escherichia coli bacterium in five 7 mL nutrient broth and five petri dishes of nutrient agar with 20 mL capacity each. Based on the instruction bottles for nutrient broth and nutrient agar, preparation of the culture media is as follows. Nutrient broth: 8 g/liter Nutrient agar: 28 g/liter Formula: C1V1 = C2V2 *Concentration *Volume Computation: What are the answers to the following. Weight in grams of nutrient broth: _________ Distilled water in mL for nutrient broth: __________ Weight in grams of nutrient agar __________ Distilled water in mL for nutrient agar: ____________
- Five ml of bacterial culture is added to 45 ml of sterile diluent. From this suspension, the following serial dilutions were made, two 1:100 and one 1:10 dilutions, and 0.1 ml is plated onto Plate Count Agar from the last dilution. After incubation, 186 colonies were counted on the plate. 1. What is the dilution factor, or how much of the original sample was diluted?The students of a Microbiology class were tasked to transfer or subculture a pure culture of Escherichia coli bacterium in five 7 mL nutrient broth and five petri dishes of nutrient agar with 20 mL capacity each. Based on the instruction bottles for nutrient broth and nutrient agar, preparation of the culture media is as follows. Nutrient broth: 8 g/liter Nutrient agar: 28 g/liter Answer the following: a. What is the weight in grams of nutrient broth? b. What is the weight in grams of nutrient agar? c. What is the distilled water in mL for nutrient broth? d. What is the distilled water in mL for nutrient agar?Ten grams of hamburger were added to 90 mL of sterile buffer. This was mixed well in a blender. One-tenth of amL of this slurry was added to 9.9 mL of sterile buffer. After thorough mixing, this suspension was further dilutedby successive 1/100 and 1/10 dilutions. One-tenth of a mL of this final solution was plated onto Plate Count agar.After incubation 145 colonies were present. How many colony-forming units were present in the total 10 gramsample of hamburger?
- A pure bacterial culture of unknown concentration was diluted to determine the concentration of viable bacteria in the original culture. Serial dilutions were performed as 2. diagrammed below. A volume of 500 µl was transferred into each tube. TSA plates were inoculated with 100 µl from the last three dilution tubes. a. If the dilution between each tube is 102, what is the volume of diluent in each of the 5 dilution tubes? Provide the volume using ml as the units. b. What is the total dilution of tube number 4? Express the total dilution using scientific notation. c. What is the concentration of viable bacteria in the original culture? Express the concentration using scientific notation and CFU/ml as the units. d. If you inoculated a TSA plate with 1.0 ml from dilution tube 4, how many colonies would you expect to form on the plate after incubation? e. If the original culture had a volume of 50ml, what was the total number of viable bacteria in the 50 ml of the original culture? 1 2 3…A bacterial culture has a concentration of 3.2 x 108 cells /mL. You dilute this culture as follows: 1/50, then 10-3and finally 1/20. If you then plate 0.2 mL of the final dilution, how many CFU would you expect following incubation?A sample of water was enumerated using a counting chamber (haemocytometer) and 220 bacterial cells were counted in 25 small squares (each of volume 2.5 x 10-7 cm3). Viable counts were carried out on the same culture using both the pour plate method (incorporating 1 mL samples of a range of dilutions into plate count agar plates) and the Miles & Misra spread plate method, where 0.02 mL samples were spread on sectors of a plate count agar plate. For the pour plate count the average of triplicate samples was 178 colonies per plate of the 10-4dilution. For the Miles and Misra count the average of triplicate samples was 21.3 colonies per sector of the 10-4 dilution. Calculate the total count and the viable pour plate and spread plate counts and suggest possible reasons for the difference between the three different counts.