QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated below in the diagram: Please ignore the fact that the fragments are colored blue and green. The coloration has no significance to this question. Also, please don't forget to answer question 61 1. Leading strand= 2. Lagging strand= 3. A single Okazaki fragment= 4. 3' end of fragment labeled "H"= 5. Replication fork= H E G 6. How many primers are required to replicate all of the DNA fragments in the above diagram (include both lagging and leading strand)?=
Q: What is the evidence that the differences in skin color in populations around the world evolved by…
A: The study of human genetics helps us understand why people from different parts of the world have…
Q: The hyphae of____ have no cross-walls. a. zygote fungi c. club fungi b. sac fungi d. all of the…
A: Fungi play a vital part in numerous biological systems by breaking down and cycling nutrients. One…
Q: please solve this step by step with clear explaination
A: To convert the given amounts of DNA from micrograms (μg) to microliters (μl), we need to use the…
Q: Read over the following article from the New York Times It describes a study in which researchers…
A: The research that looks at the hundreds of distinct chemicals that change in the bloodstream before,…
Q: describe the outcome of EGFR inhibition as well as the differences between erlotinib and…
A: 1. Outcome of EGFR Inhibition:• Cell Growth Inhibition: EGFR is a receptor tyrosine kinase (RTK)…
Q: List and describe the three ways that antibodies help eliminate pathogens
A: Sure, let's break down each mechanism:1. Neutralization: Imagine a virus trying to infect a host…
Q: STEM Workplace Practices
A: Centrifugation:Principle: Centrifugation relies on the application of centrifugal force to separate…
Q: When researchers first discovered that airflow through a bird’s paleopulmonal parabronchi is…
A: The respiratory framework of birds highlights a one of a kind instrument for gas exchange, distinct…
Q: 7:09 PM Wed Apr 10 Three strains of green-seeded lentil plants appear to have the same phenotype.…
A: PART F- The answer is yellow-seeded. To determine the phenotype of the F1 progeny resulting from…
Q: fueled.brightspace.com/d2l/le/enhancedSequenceViewer/3300467?url=https%3A%2F%2Ff59af8a9-95f5-419c-a4…
A: The objective of the question is to identify the most accurate statement about gene expression and…
Q: What does “descent with modification” mean? a. Populations that change quickly are likely to become…
A: "Descent with modification" is a core concept in evolutionary biology that Charles Darwin…
Q: . In prokaryotes and eukaryotes, describe what else is happening to the RNA while RNA polymerase is…
A: RNA synthesis, which is carried out by RNA polymerase, maybe a basic movement in both prokaryotes…
Q: Microorganisms that cause disease only when the body is already immunocompromised in some way or…
A: Option a: This option is incorrect because even in people who are feeling well, virulent viruses can…
Q: 3. Diet Big Red soda contains citric acid, as shown in the ingredient list below, Carbonated…
A: Analyzing the composition of soft drinks like Diet Big Red soda includes particular chemical and…
Q: Let's say: a drosophila melanogaster line is bred in a lab, which has a phenotypic variation of…
A: Steps involved in identifying SNP variants in the wingless gene (wg1) of Drosophila melanogaster and…
Q: 2. The following questions refer to the pedigree chart in the figure for a family, some of whose…
A: To answer these genetic questions, I'll break down each scenario, analyze the pedigree charts, and…
Q: What is the role or function of mitosis and meiosis in formation of the sperm and egg cell?
A: The objective of the question is to understand the role of mitosis and meiosis in the formation of…
Q: Genetics Q5
A: The objective of the question is to understand the effectiveness of gene therapy in treating genetic…
Q: The results of a test cross of a fruit fly that is heterozygous for three traits encoded by the…
A: To calculate the frequency of recombinations for each pair of genes, we first need to determine the…
Q: plain Constitutive and regulated enzymes with the help of a diagram.
A: In cellular metabolism, enzymes play a pivotal part in helping biochemical responses necessary for…
Q: Sanger sequencing (aka the chain termination) a. is a method for for determining the sequence of…
A: Without a doubt!Identifying the order of nucleotides in a section of DNA may be accomplished by the…
Q: Which of the following contributed to mass extinctions? a. climate change b. continental drift c.…
A: Mass extinctions are the unexpected and widespread loss of biodiversity. These events have…
Q: How would most biologists and anthropologists explain the reasons behind why primates do specific…
A: Primate behavior is generally understood by scientists and anthropologists to be the consequence of…
Q: For a virus to transform a cell, which of the following events must occur: Group of answer choices…
A: The objective of the question is to identify the necessary events that must occur for a virus to…
Q: Regulation of Genes and Their products 1. Given the following genotypes, explain how the mutation…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: What are the similarities and differences in each part of the forelimb of a moth, Pteradactyl, bird…
A: The objective of this question is to compare and contrast the forelimbs of a moth, Pteradactyl,…
Q: Poultry scientists are doing research on the design of diets that are nutritionally complete for…
A: The Specific Dynamic Action (SDA) alludes to the increment in vitality use over the basal metabolic…
Q: Microarrays a. must be preceded by a sothern blot b. compare gene expression levels across many…
A: Here's why the other options are incorrect:a. must be preceded by a southern blot: Southern blots…
Q: Please explain what is Naegleria Fowleri and why is it so important. Also, by temperatures rising…
A: References:https://www.cdc.gov/parasites/naegleria/general.htmlhttps://www.ncbi.nlm.nih.gov/pmc/arti…
Q: Question #1. Briefly discuss and compare the plant habit and reproductive structures of the…
A: Seedless vascular plants, such as Psilotum, Lycopodium, Equisetum, Selaginella, Adiantum,…
Q: In what stage of mitosis is the cell labeled "A"? A shutterstock B www.shutterstock.com 159810452 O…
A: During metaphase, which is a crucial stage of mitosis, the cell undergoes several key events as it…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: To determine the correct chromosomal condition for one daughter nucleus at telophase of mitosis, we…
Q: List the types of junctions found in animal cells, and state a function for each.
A: Animal cells have special parts called cell junctions that help cells adhere together and talk to…
Q: answer both 5 and g i also got an answer for 5 which is…
A: The genetic code is the system by which the nucleotide sequence of DNA is translated into the amino…
Q: make sure it’s correct
A: The genetic code is the system by which the nucleotide sequence of DNA is translated into the amino…
Q: What basic features of the ferns and their relatives distinguish them from any organisms studied…
A: Ferns and their close plant relatives, within the Pteridophyta group, are very curiously and old…
Q: Repeated white cell counts could be helpful in managing patients who are taking therapeutic agents…
A: The objective of the question is to determine whether repeated white cell counts can be beneficial…
Q: What happens: Rising sea surface temperatures and changes in ocean currents contribute to the growth…
A: The objective of the question is to understand how climate change, specifically rising sea surface…
Q: Fossils that serve as transitional links allow scientists to a. determine how prehistoric animals…
A: Transitional fossils play a basic part in understanding the developmental history of life on Earth.…
Q: true or false if a restriction enzyme recognizes the restriction site, 5' AACGTT3', and the enzyme…
A: 1. Recognition Site of the Restriction Enzyme:The recognition site of a restriction enzyme is the…
Q: 21. Label the structures of the male reproductive system below. 11- 10 9. 8 123 12 7 6 5
A: The male reproductive system includes the external genitals (the penis, testes and the scrotum) and…
Q: Sequence data from OTUs are provided in the table below with values provided as (percentage distance…
A: To determine the phylogenetic tree using the UPGMA procedure, we follow these steps: 1. We start by…
Q: Why are immature RBCs sometimes present in the blood? Question 7 options:…
A: The presence of immature red blood cells, also known as reticulocytes, in the blood is usually a…
Q: which of the following do researchers not need to use during vector cloning? a. a plasmid containing…
A: The objective of the question is to identify the component that is not necessary during the process…
Q: Can u give me the correct answer
A: Solution: (information required was not provided. One possible food web is provided in the image…
Q: For the VWA locus, Sophie has two alleles, 16 & 18. She inherited the allele with 16 copies from…
A: Answer well explained above
Q: Identify the pharmacological treatment options for substance abuse disorder and their associated…
A: The pharmacological treatment options for substance abuse disorders vary depending on the substance…
Q: 4. The diagram below shows the original order of the genes on an autosome in Drosophila: C D EFGHI…
A: You may refer to the following references for the answers:…
Q: Define acidosis and alkalosis. Distinguish among respiratory and metabolic acidosis and alkalosis.
A: pH is the negative logarithm of H+ concentration in a solution. The pH range goes from 0 - 14. If…
Q: Types of lipids
A: 1. Triglycerides: - Composed of glycerol and three fatty acid chains - Major form of stored energy…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Question 6-10: Choose the enzyme and match it to its function. Bubble the correct letter on the Zipgrade answer sheet. Primase DNA Polymerase Ligase Helicase Topoisomerase/gyrase а. b. с. d. е. 6. This enzyme starts the replication process with a small strand of RNA that is later replaced. 7. This enzyme removes primer and starts adding DNA. 8. This enzyme joins Okazaki Fragments. 9. This enzyme unwinds the original strands of DNA so they can act as templates. 10. This enzyme prevents supercoiling .QUESTION 2 The SARS-COV-2 pandemic resulted in the desire to design ELISA assays to either detect antibodies against SARS-CoV-2 protein (previous infection), or detect viral protein (current infection). You plan to express the mutant spike protein variant using the plasmid pictured below as your template. Here's the sequence you want to put in its place: https://www.ncbi.nlm.nih.gov/nuccore/AY429073.1?report=fasta, this is the DNA sequence you're going to buy as a gene block! But you need to add a couple things to it first so it'll get into the plasmid. To do so, you're going to need to remove the current insert (represented by the yellow arrow beginning at position 833-4867). Question: What restriction sites are you going to add at the ends of the gene? Answer can be in nucleotides or the enzyme name. For the first blank fill in the site name/sequence you'd add at the beginning of the gene (5' / C-terminus end) and for the second blank fill in the sequence/site name you'd add at the…QUESTION 3 You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1 unit/ul) and water. You want to digest 1.5 ug of plasmid DNA with 1 unit (U) of enzyme in 1X buffer in a total volume of 80 ul. Complete the table below: Solution Stock solution Working solution Volume needed restriction digestion buffer 10X 1X DNA 200 ng/ul 1.5 με enzymes 1 unit/ul 1 unit Water Total 80 μL
- Question 11 Which polymerase is responsible for transcribing RNA from a single transcription unit, generating a large transcript that is then processed to yield three types of ribosomal RNA Question 11 options: RNA Polymerase I RNA Polymerase II RNA Polymerase III DNA Polymerase Question 12 RNA splicing requires recognition of which nucleotide sequences at the boundaries of transcribed exons and introns (splice junctions)? Question 12 options: GT–AG TG-CA CT-CG CpG Question 13 Following are the three consensus DNA sequences in introns of complex eukaryotes except: Question 13 options: Splice donor site Splice acceptor site Branch site Initiation siteQUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…QUESTION 23 Michelle has a clone of the DNA of a newly discovered virus. She wants to identify which specific cells of an organ are infected by the virus. What method would be the most useful to answer this question? O restriction fragment analysis O microinjection of the gene fragment O Sanger sequencing of the clone O FISH (fluorescent in situ hybridization) O real time PCR QUESTION 24 Mutagens are useful in biotechnology research for Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answe
- QUESTION 7 After you graduate, you are working at a laboratory that identifies a novel protein called Leprechaun. To determine in which organelles Leprechaun is found, you decide to express the Leprechaun gene in HeLa cells using a plasmid. Since you have generated an antibody that recognizes an epitope within the Leprechaun protein, which technique will you use to identify its localization within the HeLa cells? OA. SDS-PAGE O B. Immunocytochemistry O C. Western blot OD. Transmission electron microscopy (TEM) OE. Immunohistochemistry QUESTION 8 Which of the following statements regarding electron microscopy is TRUE? OA. White light is utilized to illuminate the sample for imaging in all types of electron microscopy. OB. Electrons pass through the object being examined in transmission electron microscopy (TEM). OC. In scanning electron microscopy (SEM) electrons, electrons bounce off the surface of the sample. OD. Electron microscopy can be used to view structures as small as 2 nm in…Question 22 Cloning vector contains a multiple cloning site (MCS) or polylinker containing multiple unique restriction sites. It also contains markers that allow for rapid selection of colonies with insert-containing plasmids in them. The 1st statement is True and the 2nd statement is False. The 1st statement is False and the 2nd statement is True. O Both Staments are True. O Both statements are False.QUESTION 22 During the search for the Cystic Fibrosis (CF) gene the investigators used various criteria to conclude that they had arrived at a segment that represented a gene. Which of the properties below was among the criteria used by the investigators? O A. the presence of sequence palindromes O B. gene-specific restriction maps O C. interspecies sequence conservation O D. polyadenylation signals O E. the presence of AT-rich islands QUESTION 23 A feature common to activation of the myc oncogene by both the Avian Leukosis virus and the chromosomal 8:14 translocation is: O A. loss of the 1st myc exon (E1); initiation of transcription from a start site within the myc intron O B. Initiation of transcription from a strong promoter upstream from the first myc exon (E1) O C.A fusion transcript between an active upstream gene and the three myc exons O D.A DNA deletion that eliminates the transcriptional termination signal from an active upstream gene. O E. Recombination between the myc…
- Question 16 The full set of different transcripts expressed by a cell is called Question 16 options: Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is Question 17 options: allows quantification of transcripts over five orders of magnitude used to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Question 18 options: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with…Question 17 3′ CCA addition to tRNAs is necessary to ensure: Question 17 options: correct recognition of the mature tRNA by an enzyme that will covalently link the correct amino acid to the end adenosine correct recognition of the mature tRNA by ribosome proper placement of mRNA on ribosome mRNA translocation to cytoplasm Question 18 The. "S" in 28S, 18S, and 5S rRNAs represent: Question 18 options: Svedberg Unit Solution coefficient Saturation Sublimation coefficient Question 19 The catalytic function of the ribosomes is performed by: Question 19 options: RNA component Protein component 60S ribosome subunit 40S ribosome subunitQUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.