Q: What evidence did Georges Cuvier present that contradicted one of Jean-Baptiste Lamarck’s ideas? he…
A: Jean-Baptiste Lamarck was a French biologist who proposed one of the earliest theories of evolution.…
Q: Once a primary RNA transcript is created from a DNA template, it must be modified in several ways…
A:
Q: 7. What should an employee do if they believe harassment has occurred? Discuss the matter with a…
A: If an employee suspects that harassment is taking place at the workplace, he/she should follow the…
Q: What did the Scottish geologist and plant-breeder James Hutton claim about a possible evolutionary…
A: PLEASE LEAVE A HELPFUL RATING. THANKS
Q: What did Darwin observe regarding finches on different islands in the Galapagos? Different beak…
A: Choice B Explanation:Darwin noted that the various beak forms and sizes of finches on the various…
Q: Is this disease autosomal or sex-linked, and dominant or recessive? Using your genetics…
A: Based on the given information, we can conclude that the disease in question is most likely…
Q: According to Scottish geologist Charles Lyell, the Cenozoic Era (including the Eocene, Miocene, and…
A: The Cenozoic Era is the current and most recent of the three Phanerozoic geological eras, following…
Q: Submission Questions A) Explain how the structure of an enzyme makes that enzyme specific? B)…
A: Q. B answerMetabolic pathways can shift in different directions, either reversed or forwarded, based…
Q: The rate of plant growth on an island near Isle Royale is such that the carrying capacity of moose…
A: 1. Initial conditions: Initially, there are 450 moose on the island, and the environment is stable…
Q: Enzymes are not used up in chemical reactions, so what exactly does an enzyme do? Refer to…
A: Here's a breakdown of what enzymes do in terms of activation energy and transition state…
Q: Figure 1 from Wilson et al. (1990) shows the locations of the primers and the length of the PCR…
A: Sure, let's break down the figure and the modifications made:1. **Orientation and Strand…
Q: Question 19 Which of the following is FALSE in relation to CRISPR/Cas9? O Cas9 needs a PAM site…
A: Cas9 needs a PAM site consisting of an NGG sequence. True - The Cas9 enzyme requires a short…
Q: Reasons why PCR for two out of the three constructs (His-TAQ, TAQ-His, and His-TAQ-His) would not…
A: To help you understand the answer above, here is a less technical explanation of it:Imagine you have…
Q: 8. True or False: The person-centered approach focuses on the person’s personal preferences and…
A: The person-centered approach is based on the notion of acknowledging and appreciating each…
Q: True or false: Vertebrates are taxonomically more diverse than invertebrates
A: 1. Understanding Taxonomy: - Taxonomy is the science of classifying organisms into different groups…
Q: what does it mean if a ratio is 1.5
A: A ratio is a way of comparing two or more quantities. It is a mathematical expression that…
Q: You are cloning a gene called ice, which will help strawberry plants survive in cold weather, into a…
A: Other incorrect options:B. This technique involves introducing the ice gene directly into the T-DNA…
Q: The amount of this in the cell rises as DNA synthesis begins. Cis-acting element that can increase…
A: Step 1: Step 2:Step 3: Step 4:
Q: Phylogenetic tree of some deuterostome relationships 2 embryo develops anus first, mouth second 5 6…
A: Hope you understand.... Please do rate..... Thankyou :)
Q: 4. Which is an important tip to follow when toileting a person with Alzheimer’s disease?…
A: A. Providing Easy-to-Remove Clothing (Best Choice):• Dignity and Independence: People with…
Q: For the following diseases with their potential pedigree, mode of inheritance and the responsible…
A: This indicates that the condition is not inherited from the father in this case, as he is affected…
Q: Match the derived character trait to the major clade of chordates that it defines. Craniates…
A: Approach to solving the question:This discussion about derived character traits and major chordate…
Q: how is the heridetary material organised in the nucleus and the chromosomes
A: The hereditary material in a cell is organized in the nucleus, which is a membrane-bound organelle…
Q: You are studying a mammalian mitochondrion gene that has the sequence below. What is the amino acid…
A: To determine the amino acid sequence, we need to translate the mRNA sequence derived from the sense…
Q: Starting at rest, an object falls 144 feet in a vacuum (acceleration = 32 feet per second2). If the…
A: The problem is asking us to find the time it takes for an object to fall a certain distance in a…
Q: Imperial China during the Ming dynasty (1368-1644 CE) could conceivably have started the Scientific…
A: The question is asking which of the given factors would not have contributed to Imperial China's…
Q: According to Johannes Kepler’s third law, the above planet must be: closer to the sun than the…
A: Step 1: Step 2: Step 3:don't forget to upvote :) thank you and comment if doubt exists Step 4:
Q: 11. Record the systolic, diastolic, and mean arterial pressures in Table 2. DATA Table 1. Baseline…
A: In summary:Systolic pressure increased between the two trends.Diastolic pressure also increased, but…
Q: 6. What is the key to ADL success? Negative body language Doing the task for the person…
A: Preparation:Preparation is undoubtedly the cornerstone of success in activities of daily living…
Q: Which cell structure would not be a bacterial virus's first point of attachment and recognition of a…
A: Option a: This option is incorrect because bacterial viruses may use flagella as part of their…
Q: Immanuel Kant suggested, in his Investigation of the Question Whether the Earth Has Undergone Any…
A: According to this hypothesis, while the length of the year (the time it takes Earth to orbit the…
Q: Pick all that are true If a bacterium with a gene that gives resistance to the antibiotic…
A: Key references:Peechakara BV, Basit H, Gupta M. Ampicillin. [Updated 2023 Aug 28]. In: StatPearls…
Q: 5 Kinetic data was collected for a new enzyme and its substrate. The same data has been plotted in…
A: Detailed explanation: a) Let's break down the problem step by step and determine the Michaelis…
Q: You are designing a phage therapy for a cystic fibrosis patient with an multi-antibiotic resistant…
A: A. Screening a colleague's library of known Mycobacterium phages is correct because you have a…
Q: Alfred Russel Wallace and Charles Darwin accepted all of the following claims about evolution by…
A: The objective of the question is to identify the claim that was not accepted by Alfred Russel…
Q: Question 18 What is the function of the CRISPR-Cas system in nature? O part of the bacterial immune…
A: Detailed explanation: Option 1 is CORRECT because the natural function of the bacteria's CRISPR-Cas…
Q: Charles Darwin’s claim, that the species level of classification is just as arbitrary as that of any…
A: The question is asking us to identify which of the given scenarios does not support Charles Darwin's…
Q: A woman takes an antibiotic to relieve a urinary tract infection caused by Escherichia coli. The…
A: The answer explained that a woman developing a yeast infection after taking antibiotics for a UTI is…
Q: Charles Darwin’s claim, that the species level of classification is just as arbitrary as that of any…
A: The question is asking which of the given options does not support Charles Darwin's claim that the…
Q: Which of the following is considered best practice when designing protected areas? Which of…
A: It is best that the protected area is round in shape.Incorrect: While round shapes can simplify…
Q: You are studying a protein-protein interaction in 2 proteins. You decide to test both these proteins…
A: Approach to solving the question:Disulfide bonds unlikely:Disulfide bonds are probably broken by the…
Q: What is the feedback pathway for aldosterone
A: The feedback pathway for aldosterone : Aldosterone secretion is primarily controlled by two negative…
Q: Genetics Q5
A: The objective of the question is to identify the correct definition of IPS cells among the given…
Q: Which of the following examples suggested to Charles Darwin that hybridization between different…
A: Hybridization in biology is the process where two individuals of different species mate and produce…
Q: Forensics Q2
A: Note: Those in blue circles represent the DNA passed by the father to his children. Those in red…
Q: Henry Cavendish, of the Royal Society of London, discovered that water was composed of two parts…
A: The question is asking us to identify the correct composition of water according to the discoveries…
Q: From the BLAST results, identify the organism, gene, chromosome and accession number for this…
A: The given partial gene sequence corresponds to the gene ABCD1, which is located on the X chromosome…
Q: What evidence did Georges Cuvier present that contradicted one of Jean-Baptiste Lamarck’s ideas? he…
A: Georges Cuvier and Jean-Baptiste Lamarck were both influential figures in the early study of…
Q: I need help with this question, the options are physical or biological
A: Joseph Connell's original experiments in rocky intertidal communities revealed the general principle…
Q: Below is an EMSA showing four different reactions, A-D. In each tube there is some combination of…
A: Reaction A: Protein X only. No DNA probe or antibody present. This is inferred because there is no…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Molecular Biology
Strains of bacteria that have suppressor (termination codon) mutations tend to have poor growth. Why do you think this is?
Step by step
Solved in 2 steps
- Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…Consider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U U A UUU UUC- UUA UUG- CUU CUC CUA CUG- U Phe (F) Leu (L) Leu (L) Second base in codon Val (V) UCU - UCC UCA UCG CCU CCC CCA CCG AUU ACU- AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU- GUC GCC GUA GCA GUG GCG- C Ser (S) Pro (P) Thr (T) Ala (A) UAU UAC UAAT UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG A Tyr (Y) STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) Cys (C) CGU CGC CGA CGG AGU AGC AGA 1 AGG GGU- GGC GGA GGG Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A G U C A G U C A G Last base in codonIn relation to central dogma of molecular biology answer the following questions: The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect.
- The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?Exceptions to the universality of the genetic code were once thought to be rare, but more and more exceptions are being found. As mentioned in the text, one study found that a significant proportion of bacteria in the environment use nonuniversal codons. Can you think of any advantages for an organism using nonuniversal codons?
- Predict the amino acid sequence produced during translationof the short theoretical mRNA sequences below. (Notethat the second sequence was formed from the first by a deletionof only one nucleotide.) What type of mutation gave rise tosequence 2? Sequence 1: 5'@AUGCCGGAUUAUAGUUGA@3' Sequence 2: 5'@AUGCCGGAUUAAGUUGA@3'I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might wobble tend to accelerate the rate of translation?
- Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation